ID: 1055604071

View in Genome Browser
Species Human (GRCh38)
Location 9:77949614-77949636
Sequence CAGCTCTGGAAAATTGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055604065_1055604071 1 Left 1055604065 9:77949590-77949612 CCAGTATCTCAGCCCTAGACCTG 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1055604071 9:77949614-77949636 CAGCTCTGGAAAATTGGCATAGG No data
1055604064_1055604071 7 Left 1055604064 9:77949584-77949606 CCACAACCAGTATCTCAGCCCTA 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1055604071 9:77949614-77949636 CAGCTCTGGAAAATTGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055604071 Original CRISPR CAGCTCTGGAAAATTGGCAT AGG Intronic
No off target data available for this crispr