ID: 1055604493

View in Genome Browser
Species Human (GRCh38)
Location 9:77954278-77954300
Sequence CTCTAACACCATTTGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055604493_1055604495 -9 Left 1055604493 9:77954278-77954300 CCATGTGCCAAATGGTGTTAGAG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1055604495 9:77954292-77954314 GTGTTAGAGAATTCCTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055604493 Original CRISPR CTCTAACACCATTTGGCACA TGG (reversed) Intronic
902455907 1:16534102-16534124 CACAAACACCATTTCCCACATGG + Intergenic
902541516 1:17158924-17158946 CTCCACCACCATGTGGCCCAAGG - Intergenic
904302727 1:29565700-29565722 CTCTATCAACACTTCGCACAAGG - Intergenic
907146540 1:52238500-52238522 CCCTAACTTCATTAGGCACAAGG - Exonic
909640630 1:77868046-77868068 CATTAACACCATTTTGCAAATGG - Intronic
911923776 1:103800276-103800298 GTCCAACACCATTTAACACAAGG + Intergenic
914216922 1:145639843-145639865 CTCTAGCACCATTTGGTGAAAGG - Intronic
914469490 1:147962522-147962544 CTCTAGCACCATTTGGTGAAAGG - Intronic
915590663 1:156868465-156868487 CTCTAACACCCCTTGGCCCTCGG + Intronic
918975421 1:191478336-191478358 CTCTTACAACTCTTGGCACATGG - Intergenic
919187606 1:194173566-194173588 CTCTAATACAATGTTGCACAAGG + Intergenic
921274506 1:213505636-213505658 CTCTAACAGCATCTGGCCCATGG - Intergenic
921557030 1:216611242-216611264 CTCAGACACAGTTTGGCACACGG + Intronic
921656432 1:217744070-217744092 CTATAATACTGTTTGGCACATGG - Intronic
921790915 1:219289461-219289483 CTGTAAGATCATTAGGCACAAGG - Intergenic
923473309 1:234311266-234311288 CTCTCAGTCCCTTTGGCACATGG - Intronic
1067265405 10:44737841-44737863 CTCTATCACCATATGTGACATGG + Intergenic
1070055967 10:72934916-72934938 CTCTAACACCATTTAGTAACTGG + Intergenic
1072832532 10:98674126-98674148 CTACAACAATATTTGGCACATGG + Intronic
1072901456 10:99411074-99411096 CTCTCACGGCATCTGGCACATGG + Intronic
1077981626 11:7306906-7306928 CCCTAGCACCACCTGGCACATGG + Intronic
1078019637 11:7645132-7645154 CCCTAACACCATCTGTTACAAGG - Intronic
1079926722 11:26502955-26502977 CTCTACCACTATTTTGCAAATGG + Intronic
1080527292 11:33136782-33136804 CTTTAATACCTTTTGGGACAGGG + Intronic
1081004301 11:37715286-37715308 CTCTAACACTCTCTGGCACTGGG - Intergenic
1082200800 11:49364514-49364536 CTGTAAGACCTATTGGCACATGG - Intergenic
1082704294 11:56474418-56474440 TTATAACAGTATTTGGCACATGG + Intergenic
1086654875 11:89341713-89341735 CTGTAAGACCTATTGGCACATGG + Intronic
1087133632 11:94692651-94692673 CTATAACACCATTTGGTCAATGG - Intergenic
1087308310 11:96509311-96509333 CTAGAACAGTATTTGGCACATGG + Intergenic
1087590414 11:100180371-100180393 CTCTAGCACCATTTTCCAAAAGG - Intronic
1087818187 11:102682060-102682082 CTCAAAGACCATTCGGCAGAAGG + Intronic
1088210438 11:107448755-107448777 CTCTAACCTCATATGGCAGAAGG - Intronic
1092836500 12:12493982-12494004 CTAGAACACTGTTTGGCACATGG + Intronic
1097125186 12:56768838-56768860 CTCTAGCACCACTTGGCAGCTGG + Intronic
1098598625 12:72302805-72302827 CTTTACCACCCTTTGGAACAGGG + Intronic
1098655407 12:73022958-73022980 CTCTAAAACTATTTTGCTCAAGG + Intergenic
1099002977 12:77202611-77202633 CAATAACACCATGTGGCAGATGG + Intergenic
1101784328 12:107869765-107869787 CACTCACACCCTTTGTCACAGGG - Intergenic
1108364460 13:49696020-49696042 TTCTCACACTATTTGGCACAAGG + Intergenic
1108377834 13:49829689-49829711 CTCTGACACCCTTTAGCACAAGG - Intergenic
1109278184 13:60325165-60325187 CTCTAAAACCATTTGAAATATGG + Intergenic
1110114781 13:71799512-71799534 AGCTTACACCATTTGCCACATGG + Intronic
1112416528 13:99207643-99207665 CTCTAACTGCATCTGGCCCAAGG - Intronic
1117218342 14:53575540-53575562 CTCTAACCTCATGTGGCAGAAGG + Intergenic
1121625299 14:95381046-95381068 CTCTAACCTCATGTGGCAGAAGG - Intergenic
1124943543 15:34241197-34241219 CACTAGCAGTATTTGGCACATGG - Intronic
1125523554 15:40361550-40361572 CTCAAACACCCTTTGGCTCTGGG - Intronic
1125737833 15:41940513-41940535 CCCTAACACCGTGTGGCACCGGG + Intronic
1128062704 15:64745346-64745368 CTAGAACAGCATTGGGCACAGGG - Intronic
1128134468 15:65252603-65252625 CTCTAACCCCATTTGGCCAAAGG - Intronic
1131608104 15:93930937-93930959 ATTTAAAACCATTAGGCACATGG - Intergenic
1131736874 15:95342158-95342180 GCCTAACACCATTTTGCTCAGGG - Intergenic
1135905002 16:26503592-26503614 TTCTCAGTCCATTTGGCACATGG - Intergenic
1138729404 16:59178159-59178181 CTGTAGCACCCTTTGGGACATGG - Intergenic
1139876856 16:70153074-70153096 CTCTCTCACCATTTGGTAAATGG - Intronic
1140216113 16:73010277-73010299 CTTGAACTCCATTTGGCACACGG - Intronic
1140675977 16:77330207-77330229 CTCTAACACAACTTAGCTCATGG - Intronic
1142553126 17:752882-752904 CTCGAACTCCACTTGGCACATGG - Intronic
1143156764 17:4842250-4842272 CACTAACGGCATTTAGCACATGG + Intronic
1145119770 17:20247550-20247572 CTGTAACACTGGTTGGCACATGG + Intronic
1146462164 17:33054949-33054971 CTCCATCACCATTGGCCACATGG + Intronic
1151398122 17:73838507-73838529 CTCTAGCACCCCTTGGGACATGG - Intergenic
1153581823 18:6581681-6581703 CTCTTACAGCACTTAGCACAAGG + Intronic
1156140143 18:34098866-34098888 CTCTACCTCCATTTTGCAGATGG - Intronic
1156396690 18:36705541-36705563 CTCTGCCACCAGTGGGCACAGGG - Intronic
1158297827 18:56018568-56018590 ATGTAAAAGCATTTGGCACAGGG + Intergenic
1158838803 18:61360777-61360799 TTCTAACACCACTTGCCCCAAGG + Intronic
1165086354 19:33350852-33350874 TTCCAACACCATTTCCCACAGGG + Intergenic
1166291803 19:41868399-41868421 ATCGAAAAGCATTTGGCACAGGG + Intronic
929995402 2:46822946-46822968 ATCTAACACCATATGCCATATGG + Intronic
930741400 2:54836181-54836203 CTCTGACACCATGTCACACACGG - Intronic
932168892 2:69535646-69535668 CTCTTTCCCCATATGGCACATGG - Intronic
934064518 2:88328583-88328605 CTCTAAAACCATTTGGGCCTAGG - Intergenic
938393897 2:130927417-130927439 CTCTCACACCACTTGGCTCGGGG + Intronic
939557139 2:143689349-143689371 CTCTAATAAAATTTGACACAGGG - Intronic
942107019 2:172643159-172643181 CAGTAACACCATTTGGCTAATGG - Intergenic
944479928 2:200145913-200145935 CTACAACAGCATTTGGCACCTGG - Intergenic
944973676 2:205023250-205023272 TTTCAACACCATCTGGCACATGG + Intronic
945834900 2:214827859-214827881 CTCTGACACTATTTGGGACTGGG + Intergenic
946061388 2:216944646-216944668 CTCTAACACCATCTGGATCTGGG - Intergenic
946986846 2:225282922-225282944 TTCTGACACCATTTTGCCCAAGG + Intergenic
947673053 2:231953493-231953515 ATATACCACCATTTTGCACATGG - Intergenic
1168885236 20:1246710-1246732 CTTTAACATTATGTGGCACAAGG + Intronic
1169285835 20:4306374-4306396 CTCAAAGAACATTTGGCCCAAGG + Intergenic
1172200287 20:33121279-33121301 CACTAACACCAAAAGGCACAAGG - Intergenic
1172299916 20:33842159-33842181 CTCTAATGCCATGTGGTACAAGG + Intronic
1174026153 20:47577530-47577552 GTCTAGCACAATGTGGCACATGG + Intronic
1174032716 20:47643346-47643368 CTGTGACAGCATTTGCCACATGG - Intronic
1176336329 21:5602999-5603021 CTCTCAGACCTTTTGTCACAGGG + Intergenic
1176391428 21:6217949-6217971 CTCTCAGACCTTTTGTCACAGGG - Intergenic
1176469991 21:7098225-7098247 CTCTCAGACCTTTTGTCACAGGG + Intergenic
1176493552 21:7480003-7480025 CTCTCAGACCTTTTGTCACAGGG + Intergenic
1176507090 21:7658380-7658402 CTCTCAGACCTTTTGTCACAGGG - Intergenic
1182390228 22:29987774-29987796 CTCAAGCCCCATTTGGCAAACGG + Intronic
1182610067 22:31540167-31540189 CTCTAACTCCTTCTGGCACGGGG + Intronic
949337201 3:2988031-2988053 CTCTAACCACATTAGGCAAAGGG - Intronic
949415689 3:3811417-3811439 CTATAAAAGCATTTGGCACATGG + Intronic
951966422 3:28390902-28390924 CTCTATCAACATTTGCCAAAGGG + Intronic
960375516 3:116896202-116896224 TTCTAACACTATTTTGCAAATGG - Intronic
960500690 3:118434278-118434300 CTCTAATACCATTTGTTTCATGG - Intergenic
964407287 3:156362004-156362026 CTAGAACAACGTTTGGCACAGGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
973939814 4:55895563-55895585 CTCAAAAACCATATGACACATGG - Intronic
975996213 4:80319306-80319328 TTCTGACCCCATTTGGCAGAAGG + Intronic
980116369 4:128683247-128683269 CTCTGAAACGATTTTGCACATGG + Intergenic
981571429 4:146155107-146155129 CTCAAACACCATTAGACTCAGGG + Intergenic
981707720 4:147679098-147679120 TTCTCCCACCAGTTGGCACAAGG + Intronic
985969872 5:3366402-3366424 ATCTAACACCATGTGGGACCGGG - Intergenic
987368055 5:17167631-17167653 CTGGAAAACCACTTGGCACAGGG + Intronic
990142937 5:52726457-52726479 CACTAAAACCATTTGACTCATGG + Intergenic
990306673 5:54500399-54500421 ATCTAACTCTATTTGGCAAATGG - Intergenic
991426401 5:66496720-66496742 CTGTAACACCACTTGGCAGAGGG + Intergenic
993760367 5:91788147-91788169 CTCTGATACCATTTGGTAGAAGG + Intergenic
1000669562 5:164044119-164044141 CTGTATCATCATTTGGCACTTGG + Intergenic
1005711295 6:28505328-28505350 CTCTAAAAGCATTTACCACATGG + Intronic
1006889269 6:37411134-37411156 TTCTAACACCATTTGTTAAAAGG + Intergenic
1007542408 6:42660263-42660285 TTCTAAAACAATTTGGCTCAAGG - Intronic
1010712499 6:79191623-79191645 CGCTAACACCACATGGCTCAAGG + Intergenic
1011188856 6:84709312-84709334 ATCTAAAACCATGTGGCAGAGGG + Intronic
1015022482 6:128493053-128493075 CTCTAACAATATCTGGCACATGG + Intronic
1016133794 6:140512247-140512269 CTCTAGCACCATTTGTTAAAAGG + Intergenic
1020354907 7:7265484-7265506 CTCTAAAACCATCTGGCATCTGG + Intergenic
1021624969 7:22584027-22584049 CTCAAACTCCATCTGGTACAAGG + Intronic
1022218987 7:28293262-28293284 CTGTGCCAACATTTGGCACAAGG - Intergenic
1024440773 7:49414835-49414857 CTCTTACTTCCTTTGGCACATGG - Intergenic
1032928729 7:136640214-136640236 CTCTCTCACCATGTGACACACGG - Intergenic
1033931822 7:146532748-146532770 CTCCACCACCACTTGACACAAGG + Intronic
1039081928 8:33742015-33742037 CTCAAACATCATGTGACACAGGG + Intergenic
1039466534 8:37788910-37788932 GTCTAACACCATGGGGCTCAGGG + Intronic
1046420108 8:113970458-113970480 CTCTAAGAACATTTAGGACATGG - Intergenic
1049676026 8:143889585-143889607 CTCTGTCACCATGTGGCCCAAGG - Intergenic
1053239436 9:36484776-36484798 CTCAAAAACCATATGGAACAGGG - Intronic
1055604493 9:77954278-77954300 CTCTAACACCATTTGGCACATGG - Intronic
1057522260 9:95769418-95769440 CTCTAACAACATTTGGGCCAGGG + Intergenic
1060001589 9:119963745-119963767 CTCTAAAACCTGTGGGCACATGG + Intergenic
1060936066 9:127516987-127517009 CTCGTACACCATGTGGTACACGG + Exonic
1061152872 9:128838728-128838750 CTCCACCAGCATTTGCCACAGGG + Intronic
1062102904 9:134737789-134737811 CTCTAACCCCAATGGGGACAGGG - Intronic
1062125824 9:134861834-134861856 CTCCATCACCATTAGGCACCAGG + Intergenic
1203425316 Un_GL000195v1:31903-31925 CTCTCAGACCTTTTGTCACAGGG - Intergenic
1187434836 X:19258529-19258551 CTCAAACACCATTAGGGACCTGG - Intergenic
1189394206 X:40605674-40605696 CTCTTACAATATTTGGAACATGG + Exonic
1193105538 X:77667948-77667970 CTCTAACACCTTTTGTCCAAAGG + Intronic