ID: 1055605011

View in Genome Browser
Species Human (GRCh38)
Location 9:77960058-77960080
Sequence ATTCTCTTTAACCAAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055605010_1055605011 3 Left 1055605010 9:77960032-77960054 CCATTTCTTTTTTTTTTATTCAT No data
Right 1055605011 9:77960058-77960080 ATTCTCTTTAACCAAGAGAATGG No data
1055605008_1055605011 23 Left 1055605008 9:77960012-77960034 CCTTGCCTCTTCACTCAACACCA No data
Right 1055605011 9:77960058-77960080 ATTCTCTTTAACCAAGAGAATGG No data
1055605009_1055605011 18 Left 1055605009 9:77960017-77960039 CCTCTTCACTCAACACCATTTCT No data
Right 1055605011 9:77960058-77960080 ATTCTCTTTAACCAAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055605011 Original CRISPR ATTCTCTTTAACCAAGAGAA TGG Intronic