ID: 1055608889

View in Genome Browser
Species Human (GRCh38)
Location 9:78000725-78000747
Sequence GTTTATGGCTGAATCTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055608889_1055608892 17 Left 1055608889 9:78000725-78000747 CCTGCTCAGATTCAGCCATAAAC 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1055608892 9:78000765-78000787 TTACTATTCATCTTTTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055608889 Original CRISPR GTTTATGGCTGAATCTGAGC AGG (reversed) Intronic
903485213 1:23684851-23684873 TTTCATGGCGGAATCTGAGTGGG - Intergenic
905250727 1:36646549-36646571 ATTTATGGCTGGTTGTGAGCTGG - Intergenic
905936848 1:41831267-41831289 GTTAATGGCAGAAACAGAGCTGG - Intronic
908656084 1:66390359-66390381 GTTTATGTCTGAATTTGAGTTGG - Intergenic
910100607 1:83571419-83571441 GTTTATGAATGCTTCTGAGCTGG - Intergenic
921175325 1:212588272-212588294 GGTTAGGGCTGTTTCTGAGCAGG - Intronic
921293902 1:213683999-213684021 CTTCAAGGCTGAAACTGAGCTGG - Intergenic
922000277 1:221470387-221470409 GTATATGGCTGAGTCAGAGGTGG - Intergenic
922231059 1:223686662-223686684 GTTTTTGGCTTAATTTGAGTTGG + Intergenic
923526500 1:234776865-234776887 TTTTATAGCTAAATATGAGCCGG + Intergenic
924333870 1:242967462-242967484 GTTTATGACTGAAACTGACCCGG - Intergenic
1064225553 10:13481070-13481092 GTTTATGCCTAAATCTCAGCTGG - Exonic
1065008262 10:21399443-21399465 GTTTCTGTCTGATTCTGATCAGG - Intergenic
1066218413 10:33311201-33311223 GCTGATGGCTGAATCTCAGAGGG + Intronic
1071710884 10:88048043-88048065 GTTTATGGCAGACATTGAGCTGG - Intergenic
1072279818 10:93855570-93855592 GTTTATGTCTGCACCTTAGCAGG - Intergenic
1074749989 10:116576277-116576299 GTTTTTCTCTGTATCTGAGCAGG + Intergenic
1077518365 11:3016056-3016078 GCTTCTGGCTGAAACAGAGCTGG - Intronic
1078823968 11:14908322-14908344 GTTTAGTGCTGACTATGAGCTGG + Intronic
1091569383 12:1671153-1671175 ATTTATGGCAGGATCTCAGCAGG - Intergenic
1094716563 12:33019965-33019987 GTTTATGTCTGCACCTTAGCAGG - Intergenic
1095421770 12:42031534-42031556 TTTTGCGGCCGAATCTGAGCTGG - Intergenic
1106905520 13:34405237-34405259 GTTTATGGGTGAGCCTGAGAAGG - Intergenic
1109905583 13:68836081-68836103 CCTTATGGCAGAATCTGAGGTGG - Intergenic
1110327279 13:74231232-74231254 GCTTATCGCTGAAACTTAGCAGG + Intergenic
1110613408 13:77514234-77514256 GTTTGTGGCTGTATCTGTGAGGG - Intergenic
1112929699 13:104718645-104718667 GTTTATGTCTGCACCTTAGCCGG - Intergenic
1116344850 14:43779581-43779603 GGGTATGGCTGACTCTGAGACGG - Intergenic
1117488154 14:56219641-56219663 GTTTATGGATGATTCTTAACTGG + Intronic
1118746154 14:68774982-68775004 GTCTATTCTTGAATCTGAGCTGG + Intergenic
1119651100 14:76383779-76383801 ATTGATGGCTGAATCAGAACAGG - Intronic
1122701656 14:103593688-103593710 TTTTTTGGGTGAATATGAGCAGG - Intronic
1125152895 15:36553478-36553500 TTTTAAGGCTGCAGCTGAGCTGG - Intergenic
1127259343 15:57316942-57316964 GTCTATGGGTGAATCTCCGCAGG + Intergenic
1127791481 15:62402472-62402494 GTATATGCAAGAATCTGAGCTGG - Intronic
1127803088 15:62494285-62494307 GCTTATGGCTGGACCTCAGCTGG + Intronic
1135063206 16:19288271-19288293 GTTTATGGGTGCATATGGGCAGG + Intronic
1139932342 16:70538397-70538419 CTTTTTGGCTCAAACTGAGCAGG + Exonic
1140677593 16:77348512-77348534 GTTTAAGACTATATCTGAGCAGG - Intronic
1142333630 16:89472399-89472421 GTTTATTGTTGAGTCTGAGACGG - Intronic
1148201489 17:45752841-45752863 GTTTATGGCTGAAGCTCGGATGG - Intergenic
1149193927 17:54096615-54096637 GTTTATGGGTGAATTGGAGATGG + Intergenic
1153617705 18:6949893-6949915 GTTTATGCCTACATCTTAGCAGG - Intronic
1155355626 18:24950434-24950456 GTTGATGCCTGACTCTGAGTTGG + Intergenic
1156842922 18:41630522-41630544 GTTTCTGGCTGAGGCTGGGCTGG + Intergenic
1161725227 19:5924662-5924684 TTTTCAGGCTGAGTCTGAGCAGG + Intronic
1164330845 19:24253972-24253994 CTTTTTGGCAGAATCTGAGAAGG - Intergenic
1164759396 19:30717521-30717543 GGTTATGGCTGTCCCTGAGCTGG + Intergenic
1164998843 19:32744203-32744225 GTATATGGATGAATCTGACCGGG + Intronic
928092409 2:28383063-28383085 GTGTCTGGCTGAGTCTGTGCAGG + Intergenic
929552029 2:42900375-42900397 GGTTATAGCTGATTCTTAGCTGG + Intergenic
933172387 2:79138371-79138393 CTTGTTGGCTGAATCTGAGGTGG + Intergenic
933368954 2:81390931-81390953 GTTTATGTCTGCACCTTAGCAGG - Intergenic
940039322 2:149343545-149343567 GTTAATGAATGAATCTAAGCTGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945413238 2:209537789-209537811 ATTAAAGGCTGAATCTGAGGAGG - Intronic
948183874 2:236003700-236003722 GTTAATGACTGAATTTGATCAGG - Intronic
948648347 2:239423134-239423156 GTGTAACGCTGAATCTGACCAGG + Intergenic
1169844133 20:9971372-9971394 GTTTATGTCTGCACCTTAGCAGG + Intergenic
1170807825 20:19648920-19648942 GTCTCTGGCTGAATCTGTGGAGG + Intronic
1170877318 20:20262426-20262448 GCTAAGGGCTGGATCTGAGCTGG - Intronic
1171057324 20:21920088-21920110 GTTTATGGCTGCCTGAGAGCAGG - Intergenic
1171938996 20:31305968-31305990 GTCTATAGCTGAATGTGAGAAGG - Intronic
1177089226 21:16745767-16745789 GATTATGGTTAAATCTGACCAGG - Intergenic
1179712534 21:43271674-43271696 GTTTCTGGCTGGATCTGCCCAGG + Intergenic
1184756626 22:46519710-46519732 GTTTCTGGCGGCACCTGAGCAGG - Intronic
949383252 3:3469248-3469270 GTTGATGGTTGACTCTGAGCTGG + Intergenic
949484848 3:4528114-4528136 GTTCATGGCAGATTCTGGGCTGG - Intronic
952887572 3:38021032-38021054 GATGATGCCTGAATCTGTGCAGG + Intronic
955320783 3:57972816-57972838 GCTCGAGGCTGAATCTGAGCAGG - Intergenic
960827061 3:121799235-121799257 GTTGATGGCTGAATCCCATCAGG - Exonic
961167272 3:124772111-124772133 GATAATGGCTGACTCTGTGCTGG + Intronic
965700953 3:171459305-171459327 TTTTATGGCTGAACTTAAGCAGG - Intronic
970729796 4:19089453-19089475 GTTTCTGGGTGAATCTGTGAGGG + Intergenic
971179283 4:24313316-24313338 TTTGATGTCTCAATCTGAGCTGG - Intergenic
972782005 4:42294343-42294365 GCTTCTGGCTGAATATGAGAAGG - Intergenic
973245081 4:48002826-48002848 GTTTATGTCTGCACCTTAGCAGG + Intronic
973569760 4:52226099-52226121 GTCTTTGGCTGAATCTGAAAGGG - Intergenic
975167547 4:71194492-71194514 TTTTATTGCTGAAGCTGAGTTGG + Intronic
975200704 4:71584714-71584736 GATTAAGGCTGAAGCTTAGCAGG - Intergenic
980970225 4:139560419-139560441 GTTAATGGCTCTATCTGGGCAGG + Intronic
982567085 4:156998909-156998931 ATTCATGGCTGCATCTGAGCTGG - Intergenic
983775144 4:171597165-171597187 GTTTTTTTCTGAATCTGAGCTGG - Intergenic
984897545 4:184554965-184554987 GTTTTTAACTGAATCTGATCTGG - Intergenic
988676883 5:33441479-33441501 GTTTATGGCTTACTGTAAGCGGG + Intronic
994251883 5:97545253-97545275 CTTTATCGCTAAATCTGAGAAGG - Intergenic
997672006 5:135682959-135682981 TTTTATGGCTGAATGAGAGAGGG + Intergenic
1005662322 6:28011255-28011277 GTTGATGGCTGAATCCTATCAGG + Intergenic
1006228127 6:32558100-32558122 GTTTATGGATGTATCTGTTCAGG + Intronic
1008932879 6:56958076-56958098 GTTTATGCCGGAATTTGAACAGG - Intronic
1010970654 6:82259586-82259608 GCAGATGGCTGAATCTGAGTTGG - Intergenic
1012886455 6:104851457-104851479 GTTTTTGGATGATACTGAGCTGG - Intronic
1012936650 6:105375069-105375091 ATTCATGGAAGAATCTGAGCTGG + Intronic
1016316026 6:142788013-142788035 GTCTATTGCTGATTCTCAGCAGG + Intronic
1016354622 6:143204600-143204622 TCTTATGCTTGAATCTGAGCTGG - Intronic
1016434286 6:144019814-144019836 TCAGATGGCTGAATCTGAGCTGG - Intronic
1023778935 7:43637657-43637679 CTTTATGGGTGATTCTGAACAGG - Intronic
1024064962 7:45724988-45725010 GTTTATGTCTGCACCTTAGCAGG + Intergenic
1024373928 7:48617418-48617440 GATTATGGCTGAATTTGGGCAGG + Intronic
1029314022 7:99695068-99695090 CCTTATGGGTGAGTCTGAGCAGG - Intronic
1031468346 7:122141300-122141322 GTTTATGGATGACTTTGAGTAGG - Intronic
1038483282 8:27916437-27916459 GTTTATGTCTGTATATGTGCAGG + Intronic
1045834635 8:106506054-106506076 GTTTATTGATGAATCAGAGTTGG + Intronic
1046239476 8:111471848-111471870 CTTTCTTGTTGAATCTGAGCAGG - Intergenic
1047510238 8:125510277-125510299 GTTTTTAGCTGCATCTGAGGTGG + Intergenic
1052592215 9:30513285-30513307 GATTATGGCAGAAGGTGAGCGGG - Intergenic
1055608889 9:78000725-78000747 GTTTATGGCTGAATCTGAGCAGG - Intronic
1058577061 9:106415197-106415219 GGTTCTGGCTGACACTGAGCAGG - Intergenic
1188416797 X:29945086-29945108 GTTTGAGGCAGAATCTGAGAAGG - Intronic
1189754960 X:44261654-44261676 GCTGGTGGCTGAATGTGAGCAGG - Intronic
1190264422 X:48818983-48819005 GTGTATGGCTGACTCTGGGAGGG + Intronic
1191995466 X:67090660-67090682 GCTTATGGTTAAGTCTGAGCTGG + Intergenic
1195816305 X:108893364-108893386 GTTTATTGCAGAATCTAACCTGG + Intergenic
1196189392 X:112779140-112779162 GTTGGTGCCTGAGTCTGAGCAGG + Exonic
1200668855 Y:6061861-6061883 CTTTATGGTTCAATCTGAGTAGG + Intergenic
1201169121 Y:11239487-11239509 GTTTATGGCCGGATTTGAGGAGG + Intergenic