ID: 1055611693

View in Genome Browser
Species Human (GRCh38)
Location 9:78031339-78031361
Sequence GACGCGCGCCCGGGCGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 444}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055611693_1055611708 7 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611708 9:78031369-78031391 AGCTCCGGGAACCGCCGCGGGGG 0: 2
1: 0
2: 0
3: 6
4: 82
1055611693_1055611717 24 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611717 9:78031386-78031408 CGGGGGCGGCGGCCAGGGCCGGG 0: 2
1: 1
2: 21
3: 214
4: 1448
1055611693_1055611718 25 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611718 9:78031387-78031409 GGGGGCGGCGGCCAGGGCCGGGG 0: 2
1: 3
2: 21
3: 243
4: 1866
1055611693_1055611705 4 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611705 9:78031366-78031388 ACGAGCTCCGGGAACCGCCGCGG 0: 2
1: 0
2: 0
3: 2
4: 39
1055611693_1055611706 5 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611706 9:78031367-78031389 CGAGCTCCGGGAACCGCCGCGGG 0: 2
1: 0
2: 1
3: 5
4: 62
1055611693_1055611709 10 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611709 9:78031372-78031394 TCCGGGAACCGCCGCGGGGGCGG 0: 2
1: 0
2: 0
3: 11
4: 101
1055611693_1055611711 13 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611711 9:78031375-78031397 GGGAACCGCCGCGGGGGCGGCGG 0: 2
1: 0
2: 4
3: 37
4: 488
1055611693_1055611713 18 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611713 9:78031380-78031402 CCGCCGCGGGGGCGGCGGCCAGG 0: 2
1: 0
2: 22
3: 136
4: 1026
1055611693_1055611703 -7 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611703 9:78031355-78031377 GCGCGTCCGGGACGAGCTCCGGG 0: 2
1: 0
2: 1
3: 6
4: 63
1055611693_1055611716 23 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611716 9:78031385-78031407 GCGGGGGCGGCGGCCAGGGCCGG 0: 2
1: 1
2: 50
3: 336
4: 2165
1055611693_1055611707 6 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611707 9:78031368-78031390 GAGCTCCGGGAACCGCCGCGGGG 0: 2
1: 0
2: 1
3: 6
4: 79
1055611693_1055611714 19 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611714 9:78031381-78031403 CGCCGCGGGGGCGGCGGCCAGGG 0: 2
1: 0
2: 6
3: 85
4: 856
1055611693_1055611702 -8 Left 1055611693 9:78031339-78031361 CCCCCGCCGCCCGGGCGCGCGTC 0: 1
1: 1
2: 3
3: 51
4: 444
Right 1055611702 9:78031354-78031376 CGCGCGTCCGGGACGAGCTCCGG 0: 2
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055611693 Original CRISPR GACGCGCGCCCGGGCGGCGG GGG (reversed) Exonic
900019922 1:181252-181274 GAGGCGCGCCGGGCCGGCGCAGG + Intergenic
900135633 1:1115868-1115890 GACGCGGGCCCAGGCGCTGGCGG + Intronic
900180429 1:1308750-1308772 CACGTGGGCCCGGGCGGAGGCGG + Intronic
900349666 1:2228491-2228513 GCGGGGGGCCCGGGCGGCGGCGG + Intergenic
900349682 1:2228539-2228561 GCGCCGGGCCCGGGCGGCGGCGG + Intergenic
901540077 1:9910049-9910071 GGCGCGGGCCCGGGCGGTGCAGG + Intronic
901641371 1:10694698-10694720 GGCGCGGGCGCGCGCGGCGGGGG - Intronic
901797938 1:11691490-11691512 GCCCCGCGCCCTCGCGGCGGCGG + Exonic
901886896 1:12229936-12229958 GAGGCGCCCCCTGGCGCCGGCGG - Intergenic
902350112 1:15847971-15847993 GGCGGGTGCCGGGGCGGCGGCGG - Exonic
902350409 1:15849451-15849473 GACGCGCGCTCCAGCGGCGAGGG - Intronic
902402866 1:16167592-16167614 GACGCGGGCCAGGGGTGCGGTGG + Intergenic
902600963 1:17539929-17539951 GGCGCGGGCCCGGGCAGCCGAGG + Exonic
903324696 1:22563332-22563354 GGCGTGCGCACGTGCGGCGGCGG + Intergenic
903411473 1:23147011-23147033 GGCGTGAGCCCGGGAGGCGGAGG + Intronic
903907333 1:26696285-26696307 GAGGCCCGCCCGGGCGGGTGGGG + Exonic
904181305 1:28668731-28668753 GAAGCCCGGCCTGGCGGCGGCGG + Intronic
904618080 1:31760683-31760705 GGCGAGCGCCGGGGAGGCGGAGG - Intronic
904724916 1:32539774-32539796 GAGGCGGGCGCGGGCGGCGACGG - Intronic
905449114 1:38046031-38046053 CACCCGGGCGCGGGCGGCGGCGG - Exonic
905789792 1:40783963-40783985 GGGGCGGGCGCGGGCGGCGGGGG - Intergenic
905912180 1:41662487-41662509 GAGGCGCCCCGGGCCGGCGGCGG - Intronic
910251205 1:85200950-85200972 GGCGCGCGGCGGGGCGGCAGGGG - Exonic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
911208739 1:95117913-95117935 GCGGGGCGCCCGGGCGGCGCGGG - Exonic
912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG + Intronic
915458071 1:156053706-156053728 GGCGGGCGGCCGGGTGGCGGCGG - Exonic
916792505 1:168136693-168136715 GGCGCGGGCCCGGGCGGAGAGGG - Intronic
917345224 1:174022332-174022354 AACGAGCGACTGGGCGGCGGAGG - Intergenic
917934564 1:179852194-179852216 CACTCGAGCCCGGGAGGCGGAGG + Intronic
918365649 1:183805129-183805151 GTCGCGCGCACCGGCGGCGGCGG + Intronic
919247052 1:195002150-195002172 GACGTGAACCCGGGAGGCGGAGG - Intergenic
920002800 1:202811151-202811173 GACGGAGGCCCGGGCGGGGGCGG - Intergenic
920029197 1:203026494-203026516 GCCGCGCGCTTGGGCGGCGGAGG + Intronic
922648804 1:227318746-227318768 GAGGGAGGCCCGGGCGGCGGTGG + Intergenic
922705613 1:227788624-227788646 GGCAGGAGCCCGGGCGGCGGAGG + Intergenic
922762202 1:228140229-228140251 GTCTCGCGCGCGGGCGGAGGTGG + Intronic
922766247 1:228158100-228158122 GGCGTGGCCCCGGGCGGCGGCGG - Exonic
923126686 1:231039994-231040016 CGCGGGGGCCCGGGCGGCGGCGG - Exonic
923631159 1:235650107-235650129 GGCGCGGGCCCGGGCTGGGGCGG - Intronic
923684191 1:236142588-236142610 GACCCCCGCGGGGGCGGCGGCGG + Exonic
924299203 1:242620127-242620149 GACGTGAACCCGGGAGGCGGAGG - Intergenic
924563125 1:245173600-245173622 GACGCGGGCCGGGGAGGCTGTGG + Intronic
1065520574 10:26567294-26567316 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1065712827 10:28533501-28533523 GGCGGGCGCGCAGGCGGCGGCGG - Exonic
1065925848 10:30433667-30433689 GGCACGCTCCCGGGGGGCGGCGG - Intergenic
1066464199 10:35639445-35639467 GGCGGGGGGCCGGGCGGCGGCGG - Exonic
1066726779 10:38403089-38403111 AAGGCGCGCCCGTGCGGCGCCGG - Intergenic
1066726787 10:38403114-38403136 AAGGCGCGCCCGTGCGGCGCCGG - Intergenic
1070570783 10:77638175-77638197 CAGGGGCGCCCGGGCGGAGGGGG - Intronic
1070800840 10:79243568-79243590 GCTCCGCGCCCCGGCGGCGGCGG - Intronic
1071086825 10:81875239-81875261 GGCGCGGGCTCCGGCGGCGGCGG - Intergenic
1071086895 10:81875443-81875465 GGCGGGGGCCCGGACGGCGGCGG + Exonic
1072021837 10:91410285-91410307 GGCGCGGGCGCGGGCGGGGGCGG + Exonic
1072102211 10:92239833-92239855 GGCGCGGGCGCAGGCGGCGGCGG + Exonic
1072891602 10:99329715-99329737 GAGGAGCCCCCGGGCGGTGGCGG + Exonic
1075032167 10:119030612-119030634 GGCGGGCGGGCGGGCGGCGGCGG - Exonic
1075048619 10:119165667-119165689 CACGCGCGGCCTGGCGGCGGCGG - Exonic
1075207014 10:120456985-120457007 GGCGCGGGCCCAGGAGGCGGAGG + Exonic
1075748432 10:124743984-124744006 GACCCGGGGCCGGGCGGCGGCGG - Intronic
1076792878 10:132786100-132786122 GGCGGGCGGGCGGGCGGCGGCGG + Intergenic
1077063423 11:627308-627330 GAGGGGCGCCAGCGCGGCGGAGG - Intergenic
1077214543 11:1389990-1390012 GGCGCGGGCCTCGGCGGCGGCGG + Intronic
1077505850 11:2929681-2929703 GGCGAGCGCCCGGGCGGGGCGGG - Intergenic
1077870812 11:6259988-6260010 GAGGCGCCCCCGGGCGGCACAGG - Exonic
1078210313 11:9265115-9265137 GGCGGGCGCCCGGGTTGCGGGGG - Exonic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1081969147 11:47186309-47186331 GACGCGCGGGTAGGCGGCGGCGG - Intronic
1082028690 11:47589842-47589864 GAGGCCCGGCGGGGCGGCGGGGG + Exonic
1083693148 11:64423826-64423848 CACTTGCGCCCGGGAGGCGGAGG + Intergenic
1083899800 11:65638141-65638163 GACCCCAGCGCGGGCGGCGGCGG + Intronic
1084146154 11:67266432-67266454 CGCGGGCGCGCGGGCGGCGGCGG + Exonic
1084192209 11:67504424-67504446 GACGGGCGGGCGGGGGGCGGGGG - Intronic
1084425087 11:69080138-69080160 GATGCCCTCCCGGGCGGCAGTGG + Intronic
1084517098 11:69642985-69643007 GCGGCGCGACCTGGCGGCGGCGG + Intronic
1085485664 11:76860944-76860966 GCGGAGCGCCTGGGCGGCGGCGG + Exonic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1089525616 11:119094788-119094810 GACTCGAGGCCGGGCGGCGAAGG + Exonic
1089533903 11:119149338-119149360 GACGCGCCCCCGGGCCGGTGCGG - Exonic
1089993424 11:122882890-122882912 GGCGGGGGCCCGGGCGGCGGCGG + Exonic
1090699075 11:129278918-129278940 GGCGCGGGCGCGGGAGGCGGTGG + Intronic
1092256212 12:6928006-6928028 TAGGCGGGCGCGGGCGGCGGCGG + Intronic
1094147337 12:27244267-27244289 GACGGGCGCCCGGCCGGCTGCGG + Exonic
1094218512 12:27970350-27970372 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1094841355 12:34343929-34343951 GACCCGCGCATGCGCGGCGGGGG - Intergenic
1095261664 12:40105630-40105652 AGCGCGGGCGCGGGCGGCGGCGG - Exonic
1095476219 12:42589682-42589704 GGCGCGCTGTCGGGCGGCGGCGG + Intronic
1096372770 12:51083101-51083123 GACGCTGGCCCGGACTGCGGGGG - Intronic
1096541251 12:52308536-52308558 GACGCCAACCCGGGCGGAGGGGG - Exonic
1097288687 12:57896577-57896599 GACGCGGGGACAGGCGGCGGCGG - Intergenic
1097981517 12:65741644-65741666 GGGGCGGGGCCGGGCGGCGGGGG + Intergenic
1098161154 12:67649035-67649057 GAGGGGCGGCCGGGAGGCGGCGG + Exonic
1098991161 12:77065809-77065831 GACGCGGGCCCCGGCGGCCGCGG + Intergenic
1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG + Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100611534 12:96194922-96194944 GGCGCGAGCTCGGGCGACGGCGG - Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101705976 12:107221619-107221641 GGCGGGCGGCGGGGCGGCGGGGG + Intergenic
1102074442 12:110048579-110048601 GACGCGCGCCCTAAGGGCGGTGG - Intronic
1103348347 12:120265739-120265761 GGCGCGGGCGCGCGCGGCGGCGG - Exonic
1103410774 12:120710340-120710362 GGCGGGCGCCCGGGGGGCTGTGG - Intergenic
1103433063 12:120904237-120904259 GCGCCGCGCTCGGGCGGCGGCGG + Exonic
1103470005 12:121172545-121172567 GACTTGAGCCCGGGAGGCGGAGG + Intronic
1103488198 12:121296743-121296765 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1103899429 12:124295574-124295596 GACGCGCGCGCGGGGGGCGCCGG + Intronic
1103954281 12:124567658-124567680 GGCGCGAGCCCGGGAGGCGGTGG + Intergenic
1104108317 12:125683994-125684016 GACGCGCGCTCTAGCGCCGGAGG + Intergenic
1104448849 12:128853555-128853577 GTCGATGGCCCGGGCGGCGGCGG + Exonic
1104891867 12:132144075-132144097 GACGGCGGCCCCGGCGGCGGCGG - Exonic
1106602568 13:31200259-31200281 GACGCGCGCGCCGGCGGGGCAGG - Intronic
1107467806 13:40665818-40665840 GACAGCGGCCCGGGCGGCGGGGG + Exonic
1108521617 13:51251618-51251640 GGCGGGCGTCCCGGCGGCGGCGG + Exonic
1111445870 13:88345524-88345546 GACGCGGGCGCGGGCGCGGGAGG + Intergenic
1111951421 13:94712075-94712097 GGCGAGGGCCCGGGAGGCGGCGG - Exonic
1112051126 13:95644461-95644483 GACGCGGGCCGGGCCCGCGGAGG + Intronic
1112402200 13:99086716-99086738 GCGGGGCGCCCGGACGGCGGAGG + Intergenic
1112505168 13:99970912-99970934 TACGCGGGCCCGGACGGCAGCGG - Exonic
1113615663 13:111678732-111678754 GACGCGCCCCCCGGCTGCAGTGG - Intergenic
1113621131 13:111763634-111763656 GACGCGCCCCCCGGCTGCAGTGG - Intergenic
1114525671 14:23365848-23365870 GGCCTGCGCCCAGGCGGCGGAGG + Intergenic
1114674195 14:24430095-24430117 GAAGCCGGCGCGGGCGGCGGAGG + Intronic
1114882197 14:26799768-26799790 GACGTGAACCCGGGAGGCGGAGG - Intergenic
1115474523 14:33800511-33800533 GACGGGGGCCAGGGCCGCGGTGG - Exonic
1115651166 14:35403982-35404004 GGCGCCCGCCGGGGCCGCGGGGG - Intronic
1115761316 14:36581071-36581093 GACGGGCAGCCGTGCGGCGGCGG - Exonic
1115851749 14:37595019-37595041 GACGGGCGGCCGCGCGGCGCGGG + Exonic
1116835817 14:49768262-49768284 CAGGCGTGCCCCGGCGGCGGCGG + Exonic
1117545900 14:56794721-56794743 GACCCGCTTCCGGGGGGCGGCGG + Intergenic
1120881302 14:89417026-89417048 GCCGCGGGCGCGGGCGGCAGGGG + Intronic
1121648172 14:95535186-95535208 GGCTCGGGCGCGGGCGGCGGCGG + Exonic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122543346 14:102509645-102509667 GCGGCGGGCGCGGGCGGCGGTGG - Exonic
1122581982 14:102777125-102777147 GACGCGGGGACGCGCGGCGGCGG + Intergenic
1122582074 14:102777375-102777397 CCCACGCGCGCGGGCGGCGGGGG + Intergenic
1122694101 14:103544498-103544520 GAAGCCTGCACGGGCGGCGGCGG - Intergenic
1122775919 14:104116942-104116964 TCCGCGCGCCCGCGCGGGGGTGG - Intergenic
1122917322 14:104865188-104865210 GCGGCGCGGCCGGGCGGGGGCGG + Intergenic
1122975298 14:105168450-105168472 GAGCCGGGCGCGGGCGGCGGCGG - Exonic
1122975456 14:105168935-105168957 CCAGGGCGCCCGGGCGGCGGGGG + Intergenic
1122993303 14:105248994-105249016 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1123008491 14:105335825-105335847 AAGGCTCGCCCGGGCGGCCGAGG - Intronic
1124629457 15:31328222-31328244 AGCGCGCGCCCGGGCAGCGGGGG - Intronic
1125516440 15:40323761-40323783 GACGCGGAGCCGGGCGGCTGTGG + Intergenic
1125536061 15:40441601-40441623 GCAGCTCGGCCGGGCGGCGGCGG + Intronic
1127103331 15:55588537-55588559 GAGGCGCGCGCGGGCCGTGGGGG - Intronic
1127867337 15:63043061-63043083 GACGCGCGCCCTGGCCGCCCTGG - Intronic
1129292913 15:74582249-74582271 GGCGTGAACCCGGGCGGCGGAGG - Intronic
1129330875 15:74826545-74826567 GGGGCGGGCCCGGGCGGGGGCGG + Exonic
1129780155 15:78264655-78264677 GACGCGCGAGCGGGCGGCGGGGG + Intronic
1130115593 15:81002080-81002102 GGCGGGAGCCCGGGCGGCGCGGG - Exonic
1130224400 15:82046250-82046272 GGCGCGCGCCAGGCCGGGGGCGG + Intergenic
1130908467 15:88255776-88255798 GACGCGCGCCCAGCGGGCGGCGG + Intronic
1131268960 15:90935167-90935189 GGAGCGCGCCCGGGCAGGGGCGG - Intronic
1131475385 15:92734218-92734240 GGCGCGCGGCGGGGCGGAGGCGG - Intronic
1131517385 15:93088523-93088545 GGCGGGGGCCCGGGCGGCGCGGG + Intronic
1132552782 16:560259-560281 GGGGGGCGCGCGGGCGGCGGGGG + Intergenic
1132560219 16:590117-590139 GAGGTGCGCCCGGGCGCGGGCGG + Intronic
1132588177 16:715212-715234 GGCGCGGGTCCGGGCGGCGGCGG - Exonic
1132641871 16:981772-981794 GACCCGAGCCTCGGCGGCGGCGG + Intergenic
1132757508 16:1493305-1493327 GACGCGGGAGCGGGGGGCGGTGG - Intergenic
1132829035 16:1918553-1918575 GAGTCGCGCCCGGGTGGTGGCGG - Intergenic
1133223129 16:4327762-4327784 GAAGCGCGCGGGGGCGGCCGCGG - Intronic
1133316203 16:4885564-4885586 GAAGGGCGCCCGGGAGGCAGAGG - Exonic
1133784349 16:8963350-8963372 GCGGCGAGCCGGGGCGGCGGCGG + Exonic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134696980 16:16232517-16232539 GAAGCGCGCGTGCGCGGCGGCGG + Exonic
1135034731 16:19067667-19067689 GAGTTGCGCCGGGGCGGCGGCGG + Exonic
1136365179 16:29806417-29806439 GGCGGGGGCCCGGGCGGCGGCGG - Intronic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1136620937 16:31427984-31428006 GACGGGCGCGCGGGCGGCACGGG - Intronic
1136627802 16:31472459-31472481 GCCCCGCGCCCGGGCGCCCGCGG - Intronic
1136637975 16:31537718-31537740 GACGCGCCCCGGGGCCGCGCTGG + Intergenic
1136913945 16:34163716-34163738 GACGCGCGCCGGGTAGGCGGGGG - Intergenic
1137261149 16:46831044-46831066 GGCGCGCGGGCGGGCGGCAGTGG - Intronic
1137426378 16:48384851-48384873 GAGGCGGGCCCGGCCGGGGGTGG - Intronic
1137426575 16:48385388-48385410 GACGCGCGAAACGGCGGCGGCGG - Intronic
1138178704 16:54928774-54928796 CCCGCGCGCCCGCGCGGCGGAGG - Intergenic
1138450778 16:57092575-57092597 GCCGGGCGGGCGGGCGGCGGCGG - Exonic
1138681230 16:58684771-58684793 GACGCCCGCTCGGGCGGCCGCGG + Intronic
1139917886 16:70439252-70439274 GGCGCGCGTGCGGGGGGCGGAGG - Intergenic
1140222982 16:73057846-73057868 GGCGCTCGCCCGGCCAGCGGTGG + Intronic
1140223185 16:73058438-73058460 GCCCCGCGTCCGGGCGGTGGCGG + Intronic
1140514059 16:75529676-75529698 GCTGCGCTCCCGGGAGGCGGCGG - Exonic
1141164468 16:81651259-81651281 GGCGGGAGCCCGGGCGGGGGTGG + Intronic
1141430487 16:83968419-83968441 GCCCCGCGCCCGGCCGGCGGGGG + Intergenic
1141430571 16:83968613-83968635 GGCGGGCTTCCGGGCGGCGGCGG + Exonic
1141531229 16:84648448-84648470 GAGGCGGGGCCGGGCGGCGCGGG - Intergenic
1141720038 16:85750973-85750995 GAGGCCCGCCCGGGCGCTGGTGG + Exonic
1141972314 16:87492388-87492410 GGCGGGCGCCGGGGCGGGGGCGG + Intergenic
1142136328 16:88453503-88453525 GGCGCGGGCCGGGGCGGCCGCGG + Exonic
1142156148 16:88533627-88533649 GGCGCGGGCGCGGGCGCCGGCGG + Exonic
1142156306 16:88534227-88534249 GGGGCGTGGCCGGGCGGCGGGGG - Exonic
1142421380 16:89972594-89972616 TGCGCGCGCCCGGGCGGCGCGGG + Intergenic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1142716190 17:1748215-1748237 GGCGTGAGCCCGGGAGGCGGTGG + Intronic
1143026616 17:3945019-3945041 GACGCGCGGGCGGGCGGCCTGGG - Intronic
1143586527 17:7853391-7853413 GGCGGGCGCGCGGGCAGCGGAGG + Exonic
1143606521 17:7990009-7990031 GAGGCGCGATCGGGCGGCGCTGG - Intergenic
1146057696 17:29589429-29589451 GCGGCGGGCCCGGGCGGCGGCGG + Exonic
1147139698 17:38454112-38454134 GCCGCGCGCCCGGGCCGCGCCGG + Intronic
1147440331 17:40443658-40443680 GGCGCGCGGGCGAGCGGCGGAGG - Exonic
1147719808 17:42532131-42532153 GACGCCCGGCCCGGCGGCGGCGG - Intergenic
1148489182 17:48012365-48012387 GCCGCGCGCCCCGGAGGCCGCGG + Intergenic
1148685354 17:49497577-49497599 GCCGCGCGCCGAGGCGGAGGCGG - Intronic
1148818232 17:50346006-50346028 GGCGCGCGCCGGGGCGGGGCCGG - Intergenic
1148899558 17:50865991-50866013 GCCCCGGGCCCAGGCGGCGGAGG - Intronic
1149490945 17:57085038-57085060 GACCCGGCTCCGGGCGGCGGCGG + Intergenic
1149996716 17:61409634-61409656 GCCGCGAGGCCGGGCGGCGCCGG + Intergenic
1150108566 17:62479023-62479045 GGCCCGGGCCCGGGCGGCCGCGG - Exonic
1150108567 17:62479029-62479051 GACGCGGGCCCGGGCCCGGGCGG - Exonic
1150217117 17:63476994-63477016 GAAGCGCGGCGGGGCGGGGGCGG + Intergenic
1151783838 17:76265640-76265662 GCCGCGGGGCCGGGCCGCGGGGG + Intronic
1152362613 17:79839569-79839591 GCCCCGGGCCTGGGCGGCGGGGG + Intergenic
1152711154 17:81871076-81871098 GGGGCGGGACCGGGCGGCGGCGG - Intronic
1152721891 17:81927490-81927512 GCGGCGGGCCCGGGCGGTGGGGG - Intronic
1152828600 17:82483283-82483305 GACTCCAGCCTGGGCGGCGGAGG + Intronic
1152834449 17:82520135-82520157 TTCACGCCCCCGGGCGGCGGCGG + Exonic
1153219378 18:2847958-2847980 GGGGCGCGCCCGGGCCGGGGCGG + Intronic
1153277939 18:3386618-3386640 GACTTGAGCCCGGGAGGCGGAGG + Intergenic
1153900636 18:9614561-9614583 GACGCGCGCGGGAGGGGCGGCGG + Intronic
1156448650 18:37254208-37254230 GGCCCGCGGCCGGGCGGCGCTGG + Intronic
1157279102 18:46334188-46334210 GGCGCGGGCGCGGGCGGCGGCGG - Intronic
1157376986 18:47176148-47176170 GGCGCGGGCTGGGGCGGCGGCGG - Intronic
1157384058 18:47247487-47247509 GAGTCGCCCCCGGGCGGCAGCGG - Intronic
1157492808 18:48136196-48136218 GACGCCGGCCCGGGCGCCCGCGG + Intronic
1158601945 18:58863515-58863537 GCCGCCGGGCCGGGCGGCGGCGG - Intronic
1158648880 18:59269350-59269372 GGGGCGGGCCCGGGCAGCGGTGG - Exonic
1158954146 18:62523563-62523585 GACGGGCCCGCGGGCGGCGGCGG - Exonic
1158976694 18:62716444-62716466 AGCGGGCTCCCGGGCGGCGGCGG - Exonic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1160597773 18:79988829-79988851 GAGGACAGCCCGGGCGGCGGCGG - Intronic
1160659282 19:290923-290945 CACGCGGGCCCGGGAGGTGGGGG - Intronic
1160719491 19:590962-590984 GACGCGCCCCAGGGAGGCCGGGG + Intronic
1160935522 19:1592772-1592794 GGCGCGCGCCCGGCTGGGGGCGG - Intronic
1160967596 19:1753470-1753492 GACCCGGGCCCGGGCGCCGGCGG + Exonic
1161076942 19:2290400-2290422 CACGCGCGCCCGGCCCGCGCTGG + Exonic
1162033162 19:7925940-7925962 GGGGCGCGCCGGGGCGGGGGCGG - Intronic
1162046746 19:8005339-8005361 GACGCGCGCTGGGGCCGCGGCGG - Intronic
1162591887 19:11597494-11597516 GACGCGAGCCCGGGTGGGGACGG - Exonic
1162704913 19:12548299-12548321 GACGTGAACCCGGGAGGCGGAGG - Intronic
1162782017 19:13011447-13011469 CAGGTGCGCCCGGGCGGTGGAGG + Intronic
1162914086 19:13865227-13865249 GACAGGCGGGCGGGCGGCGGCGG + Intronic
1162975783 19:14206503-14206525 GCGGCGCCGCCGGGCGGCGGGGG - Intergenic
1163655573 19:18543304-18543326 GGGGCGCGGCCGGGCGGGGGTGG - Intronic
1163804129 19:19385938-19385960 GGGGCGCGCTCGGGCGGCGGGGG - Exonic
1163807085 19:19405932-19405954 CCCGCGGGGCCGGGCGGCGGAGG - Intronic
1165157271 19:33796253-33796275 GCCGCGTGGCCGGCCGGCGGGGG + Intronic
1165242806 19:34481556-34481578 GACGCAGGGGCGGGCGGCGGAGG - Intergenic
1166688309 19:44808986-44809008 GCCCCGCGCCCGGGCATCGGGGG + Intergenic
1166807698 19:45496985-45497007 GCCGAGCACCAGGGCGGCGGCGG - Exonic
1166888255 19:45973950-45973972 GCGGCGGGCGCGGGCGGCGGCGG + Intergenic
1167293229 19:48635714-48635736 GACGGGCCACCGGGGGGCGGCGG + Exonic
1167310607 19:48735498-48735520 GAACCGCTCCCGGGCGGCGTCGG - Exonic
1167352107 19:48981974-48981996 CACGCGAGCCCGGGAGGTGGAGG - Intronic
1167578346 19:50328382-50328404 GAGGCGGGCGCGGGCGGCGGCGG - Exonic
1168308939 19:55451329-55451351 GAGGCGGGCCCGGGCGGGTGGGG + Intergenic
926398031 2:12466558-12466580 GGCGCGAACCCGGGAGGCGGAGG - Intergenic
926422925 2:12716824-12716846 GAGGGGGGCCCGGGCGGGGGCGG + Intergenic
927168736 2:20350847-20350869 TGCGCGCGCCCGGTGGGCGGGGG - Intronic
927690509 2:25204673-25204695 GACGCCCGCCCGGGCCCCGTGGG + Intergenic
927713790 2:25340852-25340874 GGCCCGGGCCCGGGCCGCGGGGG - Intronic
927714211 2:25341910-25341932 GGAGGGCGCGCGGGCGGCGGCGG - Intronic
927881442 2:26692659-26692681 GGCGCGGGGCCGGGCGGAGGAGG + Intergenic
929788578 2:45008561-45008583 GCAGCGCGACCGGGCGGCCGAGG - Exonic
930011515 2:46941390-46941412 AGCGGGGGCCCGGGCGGCGGAGG - Exonic
931355829 2:61537443-61537465 GAAGCGAGCCCGGGAGGCGGCGG - Intronic
931392453 2:61855387-61855409 GGCGCACTCCCGGGAGGCGGAGG + Intergenic
931614589 2:64143832-64143854 GCCCCGCTCCCGGGCGGAGGGGG + Intronic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
934079047 2:88452270-88452292 GCCGCGGCCCCGGGGGGCGGCGG + Exonic
936412973 2:112276280-112276302 GGAGCCCGCCCGGGGGGCGGGGG - Intronic
937221747 2:120346071-120346093 GGCGCGGGCGCGGGCGGGGGCGG + Intergenic
938365033 2:130727643-130727665 GACGCGGTTCCGGGCTGCGGCGG + Intergenic
938422240 2:131154792-131154814 GACACCCTCCCGGGCGCCGGTGG + Intronic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
939969514 2:148644445-148644467 GAGGGGTGACCGGGCGGCGGCGG + Intronic
940293393 2:152098873-152098895 GGGGCGCGCTAGGGCGGCGGAGG + Intronic
942241108 2:173964674-173964696 CACCCGCCCCCCGGCGGCGGCGG + Intronic
942748718 2:179264615-179264637 GGAGCGGGCCCGGGCGGCGGCGG + Exonic
942748762 2:179264777-179264799 CGCGCGCGCCCGGGTGACGGCGG + Exonic
944515694 2:200509924-200509946 GCCGCGGGCCCGGAAGGCGGCGG - Exonic
944620184 2:201506181-201506203 GGCGCGAACCCGGGAGGCGGAGG + Intronic
945699393 2:213151668-213151690 TGCGCGAGCCCGGCCGGCGGGGG - Intronic
946856762 2:223957632-223957654 TACCGGCGCACGGGCGGCGGCGG - Exonic
947800942 2:232928229-232928251 GGGGCGAGGCCGGGCGGCGGCGG + Intronic
948046876 2:234951966-234951988 GTCCCGCGCCTGGGCGGGGGCGG - Intronic
948140503 2:235669588-235669610 AACGCGCGCCGGGGCGGGGCGGG - Intronic
948216717 2:236237824-236237846 GACGCCAGCCCCGGCGGCCGCGG - Exonic
948368939 2:237475333-237475355 GAGGCGGGGCCGGGCCGCGGGGG + Intergenic
948645383 2:239400892-239400914 GGCTCGGGCTCGGGCGGCGGCGG + Exonic
948801377 2:240435135-240435157 GAGGCGCGGCCGGCGGGCGGAGG + Intergenic
948983973 2:241508805-241508827 GCCGCGCGCCTGGGCGGGCGGGG + Intronic
948991763 2:241559167-241559189 GACGAGTGCGTGGGCGGCGGGGG - Intronic
1168757120 20:325581-325603 GCGGCGCGCGCGGGCCGCGGCGG + Exonic
1168878131 20:1185177-1185199 GAAGGGCGCCCGGCCGCCGGCGG + Intronic
1169191399 20:3660924-3660946 CAGGTGCGCGCGGGCGGCGGCGG - Exonic
1169800341 20:9507097-9507119 GTCGGGAGCCCAGGCGGCGGAGG - Intergenic
1170617807 20:17968489-17968511 GAGAGGCGCCCAGGCGGCGGCGG - Intronic
1171810129 20:29740885-29740907 GATGCGCGCCCGGCAGGCGGGGG + Intergenic
1173752481 20:45488029-45488051 GACGTGAACCCGGGAGGCGGAGG - Intergenic
1174357778 20:50009949-50009971 GAGGGGCGCCCGGGCTGCGAGGG - Intergenic
1175215321 20:57389389-57389411 GAGGCGGGCCCGGGCGGCGCTGG + Intergenic
1175429529 20:58891686-58891708 GGGGCGCGGCCGGGCTGCGGCGG - Intronic
1175847115 20:62065019-62065041 GGCGGGCGCGGGGGCGGCGGGGG + Exonic
1175847421 20:62065933-62065955 GGCGCGCGGCCGGGGGGCGGGGG + Intergenic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176201550 20:63863043-63863065 GACGCGGGGCGGGGCGGGGGGGG + Exonic
1176380688 21:6111016-6111038 GGCCCCCGCCCGGGCGGCGGGGG + Intergenic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1179363152 21:40731735-40731757 GACTCTCACCCGGGGGGCGGGGG - Intronic
1179742784 21:43427224-43427246 GGCCCCCGCCCGGGCGGCGGGGG - Intergenic
1180791468 22:18577657-18577679 CGCGCGCGCCCGGGCGACGTGGG - Intergenic
1181057763 22:20268032-20268054 CACCCGAGCCCGGCCGGCGGCGG - Intronic
1181230271 22:21417654-21417676 CGCGCGCGCCCGGGCGACGTGGG + Intronic
1181248379 22:21517209-21517231 CGCGCGCGCCCGGGCGACGTGGG - Intergenic
1183349119 22:37324918-37324940 GCAGCGCGCCCGGGTGGCGCGGG - Intergenic
1183486188 22:38088895-38088917 GGCGAGCGCCCGGGCGGCGGCGG - Exonic
1184101497 22:42343719-42343741 GAGAGGCGCCCGGGCGGCGCGGG + Intergenic
1184276478 22:43411946-43411968 GGCGCGCGGGCGGGCGGCGGAGG + Intronic
1184412216 22:44331843-44331865 GGCGGGCGGCCGGGCGGCGCGGG - Intergenic
1184523847 22:45010014-45010036 GGAGCGGGCCGGGGCGGCGGGGG + Intergenic
1184767038 22:46577406-46577428 GGCTCGGGCCCGGGCGGCGGCGG - Intronic
1185037915 22:48489413-48489435 GGCGCGAGCGCGGGCGGCGCGGG + Intergenic
1185055286 22:48575918-48575940 GGAGCGAGCGCGGGCGGCGGAGG + Intronic
1185291426 22:50029645-50029667 GGCGCGAACCCGGGAGGCGGAGG + Intronic
1185360347 22:50403121-50403143 GACGTGAACCCGGGAGGCGGAGG + Intronic
1185398543 22:50604548-50604570 GCGGCGGGCGCGGGCGGCGGCGG - Exonic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
949559475 3:5188323-5188345 CGCGCGGCCCCGGGCGGCGGGGG - Intronic
949969972 3:9396654-9396676 GAAGCGCGCGCTGGAGGCGGGGG - Intergenic
950509991 3:13420288-13420310 GGCGCGCGCGCGGGCGGGAGCGG - Exonic
950729783 3:14947601-14947623 TACCAGCGCGCGGGCGGCGGCGG + Intronic
951543626 3:23806111-23806133 GCGGCGCGGCCGGGGGGCGGCGG - Intronic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
953982171 3:47418405-47418427 GTGGTGGGCCCGGGCGGCGGAGG - Exonic
954367816 3:50155523-50155545 CCTGGGCGCCCGGGCGGCGGCGG - Exonic
954778968 3:53045640-53045662 GAGGCGCCAACGGGCGGCGGCGG - Intronic
956432278 3:69199186-69199208 GGCGTGCACCCGGGAGGCGGAGG + Intronic
961551644 3:127673148-127673170 GACGGGCGGCTGGGCGGCCGCGG + Intronic
961664351 3:128486822-128486844 GACGCGCGCCCGCGCGTGAGCGG + Exonic
963133245 3:141877028-141877050 GACCCTAACCCGGGCGGCGGCGG + Intronic
963732640 3:148987671-148987693 GGCGGGCGGCCGGGTGGCGGCGG - Intergenic
965166224 3:165196485-165196507 GACGCTCGCGGCGGCGGCGGCGG + Intronic
965962130 3:174441219-174441241 GAGGGGCGCCCGGCCGGCGGCGG + Intronic
966712080 3:182980890-182980912 GAAGCGGGCACGAGCGGCGGCGG + Intronic
966743393 3:183254069-183254091 GAGGCGCGGCGGGGCGGGGGCGG - Intronic
966860628 3:184229549-184229571 GGCGCGGGCCCTGCCGGCGGTGG - Intronic
967858277 3:194134355-194134377 GGCGGGCGCCCGGGAGGAGGCGG - Intergenic
967924181 3:194633369-194633391 GGCGCGCTCCCGGGCGCGGGCGG + Exonic
968372773 4:11118-11140 GACGCACGCCGGCGCGGCGCCGG + Intergenic
968372824 4:11290-11312 GACGCACGCCGGCGCGGCGCCGG + Intergenic
968404157 4:325313-325335 GGCGCGAACCCGGGAGGCGGAGG + Intergenic
968434111 4:576201-576223 GATGCGGGCTCCGGCGGCGGCGG - Intergenic
968651852 4:1763317-1763339 GACGGGCGGCCGGGCTGGGGAGG + Intergenic
968701323 4:2059463-2059485 GGGACGCGGCCGGGCGGCGGCGG - Intergenic
969240376 4:5893114-5893136 GGCGCGCGCCGGGGCGGGGCCGG + Intergenic
974047116 4:56907798-56907820 GCCACGCGCGCGGGCGTCGGAGG + Intergenic
975166863 4:71187201-71187223 GGCGCGAGCCCGGGACGCGGCGG - Intergenic
975801062 4:78059101-78059123 GAGCCGCGGCTGGGCGGCGGCGG + Intronic
976226587 4:82799021-82799043 CACCCGCCCCCGGGCGGAGGCGG - Intergenic
976246802 4:83012806-83012828 GCCGCGCGACCAGGAGGCGGCGG - Intronic
976431236 4:84965994-84966016 GCCGCCCACCCTGGCGGCGGCGG + Intronic
977574095 4:98658758-98658780 CGGGCGCTCCCGGGCGGCGGTGG + Intergenic
978384475 4:108166953-108166975 GGCGCGCACCCGGGCTGCGGGGG - Intronic
979205557 4:118033596-118033618 GGCTCCCGCCCGGGAGGCGGTGG + Intronic
981331385 4:143513952-143513974 GGCGCGCTCTCGGGAGGCGGGGG - Exonic
985462621 4:190121448-190121470 GACGCACGCCGGCGCGGCGCCGG - Intergenic
985462740 4:190122022-190122044 GACGCACGCCGGCGCGGCGCCGG - Intergenic
985896294 5:2751562-2751584 CCCGCGGGCCGGGGCGGCGGCGG + Exonic
985897110 5:2755237-2755259 GTCGTGCGCGCGGGCGGCGAGGG + Exonic
986748039 5:10761179-10761201 GACGCGCGCGCGTGGGGCGCCGG + Exonic
987099789 5:14581800-14581822 GAAGCGAGCCCGGGCGCCGGCGG + Exonic
987108703 5:14664882-14664904 GACGCCGGCGCGGGAGGCGGCGG + Exonic
987340447 5:16935472-16935494 GGCGCGCGCCGGGGCGCGGGCGG - Intronic
990699514 5:58460180-58460202 CACGCGCGCTCGGCCGGCCGTGG - Exonic
992473186 5:77077511-77077533 GCAGCGGGGCCGGGCGGCGGCGG + Exonic
993174457 5:84465877-84465899 GGCGCGAACCCGGGAGGCGGAGG - Intergenic
993464205 5:88225049-88225071 GACGTGAACCCGGGAGGCGGAGG - Intronic
993651707 5:90529743-90529765 GACCCGCCCCCGGGCCCCGGAGG - Intronic
995853995 5:116574157-116574179 GGGGCGCGCCCGGGCGCCCGGGG + Intronic
998143230 5:139711334-139711356 GACGCGCTCGGCGGCGGCGGCGG - Intergenic
998166643 5:139848189-139848211 GCAGCGCGCACGGGCGGCGAGGG - Exonic
998583756 5:143404798-143404820 GACGCGGGCCCTGGCCGGGGTGG - Intronic
1001065081 5:168529598-168529620 GGCGCGGGCAAGGGCGGCGGGGG + Exonic
1002515302 5:179753744-179753766 AACCCGGGCCCGGGAGGCGGAGG - Intronic
1002580941 5:180209141-180209163 GCCGGGCGGTCGGGCGGCGGCGG - Intronic
1003995575 6:11537400-11537422 GGCGCGCGCCCGGGGTCCGGGGG + Intergenic
1004208614 6:13615382-13615404 GTCTCGCGCCCCGGCGTCGGCGG + Exonic
1004229077 6:13814582-13814604 GACGCGCGCCGGGGGTGGGGTGG + Intergenic
1004396341 6:15248820-15248842 CAGGCGCGGCGGGGCGGCGGGGG + Intronic
1005825999 6:29632331-29632353 CGCCCGCGCCCGGGGGGCGGAGG + Exonic
1006137117 6:31901957-31901979 GACGCGCGCGCGCGCGGGGCCGG + Exonic
1007327312 6:41072584-41072606 TACGCATGCGCGGGCGGCGGCGG - Exonic
1007739500 6:44002258-44002280 GGCGTGGGCGCGGGCGGCGGGGG - Intronic
1007739653 6:44002831-44002853 CGCGCGCGCCCCGTCGGCGGCGG - Exonic
1008116913 6:47561862-47561884 GACGTGAACCCGGGAGGCGGAGG - Intronic
1009952629 6:70413955-70413977 GACGCGCGCAGGGGCAGGGGCGG - Intronic
1010703257 6:79077608-79077630 GCCCCGCGCCCTGCCGGCGGCGG + Intronic
1012939673 6:105403223-105403245 TCCGTGCGCCCGGGCGGCGCGGG - Intergenic
1013273188 6:108560829-108560851 GACCTGCGGCTGGGCGGCGGGGG + Intronic
1013619400 6:111873226-111873248 GCGGCGCGCCCGGGCGGGAGAGG + Exonic
1014724810 6:124962124-124962146 GACGCGCGGCCCGAGGGCGGTGG - Intergenic
1015251844 6:131135588-131135610 TGCGGGGGCCCGGGCGGCGGAGG - Intergenic
1016447792 6:144150647-144150669 GACGCGCGCCCTGCCGGGAGAGG + Exonic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1017672246 6:156778741-156778763 GCCGGGGGCCCCGGCGGCGGCGG - Exonic
1017877567 6:158536971-158536993 GCTCCGCGCCCGGCCGGCGGAGG - Intronic
1018613020 6:165662087-165662109 GGCGCCGGCCCAGGCGGCGGCGG - Intronic
1018871355 6:167785576-167785598 GACGTGAACCCGGGAGGCGGAGG + Intronic
1018876007 6:167823790-167823812 GACGTGAACCCGGGAGGCGGAGG - Intergenic
1019274715 7:169949-169971 GTCGGGCGCCCGGGCTGAGGAGG - Intergenic
1019342890 7:516953-516975 GACGGGCGGGCGGGCGGAGGCGG - Intronic
1019689575 7:2403312-2403334 GCCGCGCGCCCGGTCCGCCGGGG + Intergenic
1019743769 7:2688409-2688431 CGAGGGCGCCCGGGCGGCGGCGG + Intronic
1020178137 7:5898935-5898957 GGCGCGCGGGCGGGCGGCGCCGG + Intronic
1020278347 7:6637644-6637666 GACGGGGGTCCGGGAGGCGGGGG - Intronic
1020304790 7:6826040-6826062 GGCGCGCGGGCGGGCGGCGCCGG - Intronic
1021452781 7:20798069-20798091 GCCGCGGGCGCGGGAGGCGGAGG + Intergenic
1021827913 7:24573264-24573286 GGAGCGCGCCCAAGCGGCGGCGG + Intronic
1021828007 7:24573635-24573657 GCCGCGCGCCGGGCCGGCCGGGG + Intronic
1021998337 7:26201635-26201657 GGCGCGCGCCCGGCGGGGGGAGG - Intronic
1022230776 7:28410154-28410176 GGCGCGCGCCCGGGGAGGGGAGG + Intronic
1022375559 7:29807581-29807603 GGCGGGCGCCGGGGCGGCGTGGG + Intronic
1023937172 7:44748548-44748570 GGGGCGGGGCCGGGCGGCGGAGG - Intergenic
1023951268 7:44847988-44848010 GGCGCGCGGCCGAGCGGAGGCGG - Exonic
1024920230 7:54546576-54546598 GACGCGCGCCCGGAGGTGGGTGG - Intronic
1026882680 7:73917427-73917449 GGCGTGCACCCGGGAGGCGGAGG + Intergenic
1027374631 7:77537491-77537513 GCCGGGCGGGCGGGCGGCGGGGG + Exonic
1029483844 7:100827551-100827573 GAGGGGCGCGCGGGGGGCGGGGG + Intronic
1029658503 7:101943471-101943493 GATGCTCTCCCGCGCGGCGGCGG + Intronic
1030121216 7:106112327-106112349 GAGGCGGGCCCGGGCGGCCGTGG + Intronic
1031484992 7:122315094-122315116 GACGCGCGCCCTGGCGGTCTGGG - Intergenic
1033120736 7:138664800-138664822 GTCGAGCGCCGGGGTGGCGGAGG - Intronic
1033299935 7:140176664-140176686 GAGGCGCGGGCGGCCGGCGGCGG + Intronic
1034147329 7:148884471-148884493 CGTGCGCGCGCGGGCGGCGGCGG + Intergenic
1035266102 7:157691006-157691028 GGCGCGCACCCGGCCGGCGGCGG + Intronic
1035553011 8:544647-544669 CACCTGCGCCTGGGCGGCGGCGG + Exonic
1036562186 8:9906723-9906745 GACGCCCGCCCAGGCGGGGTGGG - Intergenic
1036910792 8:12755463-12755485 GCCGCGCGCCCGGGAGGCTCCGG - Exonic
1037273760 8:17156614-17156636 GACGGGCTCCTGGGCGGCGGCGG - Exonic
1038761264 8:30385220-30385242 GGCGCGGGCCCGGGGCGCGGCGG + Intronic
1038808062 8:30812649-30812671 GGCGCGCGGCCGGGCGGGGAAGG - Exonic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1040065338 8:43140415-43140437 GACGGGCGCGCGGGCGTCCGCGG + Intergenic
1041167363 8:55102735-55102757 GTCGCCGGCCCGGGCGGCGGCGG + Exonic
1042216352 8:66432521-66432543 GACCCGGGCTCGGGCGGCAGCGG - Exonic
1042962871 8:74321507-74321529 GGCGCTGGCCCAGGCGGCGGCGG - Intronic
1045674089 8:104589054-104589076 GGAGCGCGCGCGGGCGGCGGCGG - Intergenic
1047549901 8:125859575-125859597 GACGTGAACCCGGGAGGCGGAGG + Intergenic
1048345535 8:133572068-133572090 GCCGCGCGCAGGGGAGGCGGTGG - Intergenic
1049079746 8:140432786-140432808 GACGTGAACCCGGGAGGCGGAGG + Intronic
1049419545 8:142510757-142510779 GCCGCGGGGCCTGGCGGCGGCGG + Intronic
1049452470 8:142669673-142669695 GCCGCGCGCTCAGGCCGCGGGGG + Intronic
1049707730 8:144050652-144050674 GGCGCGTGCCCAGCCGGCGGGGG - Intergenic
1049801017 8:144517576-144517598 AGCGCGCGGCGGGGCGGCGGGGG - Intronic
1049842736 8:144784074-144784096 GGCGCGAACCCGGGAGGCGGAGG + Intronic
1051896526 9:21994615-21994637 GGCGCGCGCGCGGGCGGCTCAGG + Intronic
1054695674 9:68357179-68357201 GACCAGCGGCCGGCCGGCGGCGG + Exonic
1055090988 9:72364798-72364820 GACCCGCTCCCGGCCCGCGGCGG - Intronic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1056475277 9:86946751-86946773 GCCGCGCTGCTGGGCGGCGGCGG - Exonic
1056992302 9:91423604-91423626 GCCGGGCCCCCGGCCGGCGGTGG + Intronic
1057063519 9:92026628-92026650 GACGCGCGGCCGCGAGGCAGGGG - Intergenic
1057600125 9:96450447-96450469 GAGGCGCGACGAGGCGGCGGCGG + Exonic
1057716701 9:97501652-97501674 GACGAGCTCCCGGGCGGCCGCGG - Exonic
1057758088 9:97853120-97853142 GAGGTGCGCCCGGGCCCCGGGGG + Intergenic
1057773103 9:97984243-97984265 GGGGCGGGCCAGGGCGGCGGAGG + Intronic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1058110737 9:101028865-101028887 TGCGCGCGCCCGTGGGGCGGAGG - Exonic
1059102549 9:111484087-111484109 GGCCCGCCCCCGGGCCGCGGGGG - Exonic
1059140297 9:111846987-111847009 GACTCGAACCCGGGAGGCGGAGG - Intergenic
1059145633 9:111896985-111897007 GGCGCGCTCGCGGGCGGCTGCGG - Exonic
1059257666 9:112945743-112945765 GAACTGCGCCCGGGCGGCAGCGG + Intergenic
1060051753 9:120383148-120383170 TGTGCGCGCCCTGGCGGCGGGGG - Intergenic
1060770167 9:126326792-126326814 GGGGCGCGGCCTGGCGGCGGCGG - Intergenic
1061449662 9:130661242-130661264 AATGGGGGCCCGGGCGGCGGCGG + Intergenic
1061486655 9:130923751-130923773 GACATGCGCACGGACGGCGGCGG - Exonic
1062272121 9:135714433-135714455 GGCGGGCGGCCGGGCGGGGGCGG - Intronic
1062461898 9:136665765-136665787 GGCGCGGGCTCGGGCGGCAGTGG + Intronic
1062476017 9:136727962-136727984 GATGGGGGCCCGGGCCGCGGAGG - Intergenic
1062501809 9:136855007-136855029 GACGGGGGCCCGGGGGGCGCCGG - Exonic
1062517704 9:136944501-136944523 GACGAGCGCACGGGCGGCCTCGG + Intronic
1062596545 9:137302336-137302358 GACGCGCGCGCCGGCGGCCCCGG + Intergenic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1185493219 X:535419-535441 GACGTGAACCCGGGAGGCGGAGG - Intergenic
1186496450 X:10015543-10015565 GCGGGGCGGCCGGGCGGCGGCGG + Exonic
1187172996 X:16869996-16870018 GGCGCGCGCCGGGGCCGCGGGGG - Intronic
1187507265 X:19887751-19887773 GACGCGCGGCCGCCGGGCGGGGG + Intergenic
1187670120 X:21658494-21658516 GGGGCGCGCCCGGGAGGCCGAGG - Intergenic
1187826192 X:23334810-23334832 GGCGCGGGTTCGGGCGGCGGCGG - Exonic
1195716966 X:107826758-107826780 GACTCGCGCCCAGGCGCCGGGGG - Intronic
1198158595 X:133985693-133985715 GCCGCGCGGCCAGGGGGCGGTGG + Intronic
1199736804 X:150693346-150693368 GCCGCGCGCGCGGGGGTCGGGGG - Intronic
1199746809 X:150776833-150776855 GACACGCGCCAAGGTGGCGGGGG + Intronic
1200100749 X:153688284-153688306 GGGGCCCGGCCGGGCGGCGGCGG - Exonic
1200229505 X:154437048-154437070 GAGGCGAGCCGGGGAGGCGGTGG + Exonic