ID: 1055620765

View in Genome Browser
Species Human (GRCh38)
Location 9:78122671-78122693
Sequence AAACTTAACATGTCCAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055620761_1055620765 3 Left 1055620761 9:78122645-78122667 CCACTGAGATTTCTCGGAGACCC No data
Right 1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG No data
1055620759_1055620765 17 Left 1055620759 9:78122631-78122653 CCTACTTGATATGTCCACTGAGA No data
Right 1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055620765 Original CRISPR AAACTTAACATGTCCAAAAA TGG Intergenic
No off target data available for this crispr