ID: 1055624948

View in Genome Browser
Species Human (GRCh38)
Location 9:78166836-78166858
Sequence CAGGGAAAAAAGCAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055624948_1055624953 -4 Left 1055624948 9:78166836-78166858 CCTTCTTCCTGCTTTTTTCCCTG No data
Right 1055624953 9:78166855-78166877 CCTGACAAAAGCATGAGGCTTGG No data
1055624948_1055624955 26 Left 1055624948 9:78166836-78166858 CCTTCTTCCTGCTTTTTTCCCTG No data
Right 1055624955 9:78166885-78166907 ACAGCTATCTTGAGGCCATGAGG No data
1055624948_1055624954 18 Left 1055624948 9:78166836-78166858 CCTTCTTCCTGCTTTTTTCCCTG No data
Right 1055624954 9:78166877-78166899 GAACTACAACAGCTATCTTGAGG No data
1055624948_1055624950 -9 Left 1055624948 9:78166836-78166858 CCTTCTTCCTGCTTTTTTCCCTG No data
Right 1055624950 9:78166850-78166872 TTTTCCCTGACAAAAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055624948 Original CRISPR CAGGGAAAAAAGCAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr