ID: 1055626053

View in Genome Browser
Species Human (GRCh38)
Location 9:78178603-78178625
Sequence GTCCCACGGTGCCACGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055626048_1055626053 1 Left 1055626048 9:78178579-78178601 CCAGCAGGAGGGGGCCAAGTATG 0: 1
1: 4
2: 3
3: 5
4: 143
Right 1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG 0: 1
1: 0
2: 3
3: 10
4: 60
1055626042_1055626053 23 Left 1055626042 9:78178557-78178579 CCTGCAAACAAATGGAAATTGTC 0: 1
1: 0
2: 3
3: 21
4: 244
Right 1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG 0: 1
1: 0
2: 3
3: 10
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055626053 Original CRISPR GTCCCACGGTGCCACGGGAA AGG Intergenic
900527369 1:3135816-3135838 GGCCCAGGGAGCCACGGGGAAGG - Intronic
903068002 1:20711542-20711564 GTCCATCGCTGCCACGGGGAGGG + Intronic
903446397 1:23424939-23424961 GTCCCCCGGCGCCCCTGGAAGGG - Intergenic
914407282 1:147389093-147389115 GTGCCCCTGTCCCACGGGAAAGG - Intergenic
1063387137 10:5623120-5623142 GTCCCAGGGAGCCACGGGCTGGG - Intergenic
1073833227 10:107411004-107411026 ATCCCCCGGTGTCAAGGGAAGGG + Intergenic
1075255525 10:120923572-120923594 GGCCCATGTTGCCATGGGAATGG + Intergenic
1075284023 10:121167344-121167366 GTCCCTCTGTGCCACTGCAAGGG - Intergenic
1079019523 11:16897634-16897656 ATCCCGCTGTGCCACGTGAAAGG + Intronic
1085691516 11:78667981-78668003 GTCCCAGGGTCCCACAGGCAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090274199 11:125408352-125408374 CTCCCACGGGGCCCCAGGAAGGG + Intronic
1090749026 11:129729885-129729907 GTCCCACAGTCACACGGAAAAGG - Intergenic
1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG + Intergenic
1099328699 12:81253312-81253334 CTGCCACGGTACCATGGGAAAGG - Exonic
1103905470 12:124325346-124325368 GTCCCAGCGAGCCACAGGAACGG - Exonic
1104686596 12:130788853-130788875 GTCCCACTCAGCCCCGGGAAGGG - Intergenic
1118642575 14:67806389-67806411 CTCCCACAGTCCCATGGGAAAGG - Intronic
1118990454 14:70792720-70792742 GTCCCAGGGTGCCACAGGTCTGG + Intronic
1128467521 15:67925337-67925359 TTCCTACATTGCCACGGGAAAGG - Intergenic
1130524009 15:84687761-84687783 GTTCCATGCTGCCACTGGAAGGG + Exonic
1132049593 15:98596108-98596130 GCTCCACTGTGCCACGAGAAAGG + Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1132581773 16:688080-688102 CTCCCACAGGGCCACGGGAGTGG - Intronic
1136366887 16:29813104-29813126 GTCCCAAGGTTCCAGGCGAAGGG + Exonic
1139430826 16:66910279-66910301 ACCCCACGGTGCAACGGGATTGG - Exonic
1142556650 17:782730-782752 GTTCCGCTGTGCGACGGGAAGGG - Intronic
1143401880 17:6651617-6651639 ATCCCACAGTGCCCCGGGACCGG - Exonic
1143881789 17:10035506-10035528 TTCCCACAGTGCCAGGGGAAGGG - Intronic
1145385546 17:22409398-22409420 GTCCCGCGTTGCCAAGGGACTGG - Intergenic
1147617451 17:41837920-41837942 GTCCCAGGGTGCCATGGAGATGG + Exonic
1152184367 17:78844794-78844816 GTGCCACAGGGCCACAGGAAGGG - Intergenic
1158536992 18:58317201-58317223 GCTCCAGGGTGCCACGGGAGGGG + Intronic
1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG + Intronic
1160962999 19:1732624-1732646 GGCACAGGGTGGCACGGGAAGGG + Intergenic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1166051234 19:40261582-40261604 GTCCCATGGTGAAAGGGGAAGGG - Intronic
1167271719 19:48509976-48509998 ATCCCATGGTGTCCCGGGAAAGG - Intronic
1202668301 1_KI270709v1_random:20235-20257 GTCCCATTGTGCTACAGGAAGGG - Intergenic
925417157 2:3678373-3678395 GTCCCACAGTGCCAGAGGAACGG - Intronic
927204295 2:20597280-20597302 GTCCAAGGCTGCCAGGGGAATGG - Intronic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
932605512 2:73163082-73163104 GCCCCACGGGGTCAGGGGAAGGG + Intergenic
948991717 2:241559027-241559049 TGCCCGGGGTGCCACGGGAACGG + Intronic
1170868994 20:20187318-20187340 GGCCCAGGGTGCCAGGGGCAGGG + Intronic
1174377830 20:50138279-50138301 GTCACACGGTGGCAGGGGCAAGG + Intronic
1175761137 20:61562702-61562724 CTCCCACCTTGCCATGGGAATGG + Intronic
1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG + Intergenic
1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG + Intronic
1183326621 22:37198051-37198073 GTCCCAGGGTGCCTGGGAAAGGG - Intronic
1185067438 22:48639237-48639259 GACCCACAGTGCCACTGGGAAGG - Intronic
950364379 3:12472674-12472696 GTCCCACGGTGTCATGGTGAGGG - Intergenic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
961448515 3:126992106-126992128 GCCCCACGGTGGCAGGGGGAGGG + Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
969436750 4:7193156-7193178 GTCCCGCGGTGTCCCGGGTAGGG - Intronic
969689293 4:8695246-8695268 GTCCCACGGAGGCAGGTGAAAGG - Intergenic
976717250 4:88136115-88136137 CTCCCAGGGTGCTGCGGGAATGG + Intronic
981077166 4:140603277-140603299 CTCCCACGGTGCCCCGCTAATGG + Intergenic
997369402 5:133348514-133348536 GTCCCAGGATGCCATGGGAAAGG + Intronic
998128636 5:139640106-139640128 CTGCCAGGGTGCCACGGGAAGGG - Intergenic
1002606982 5:180389387-180389409 GGCCCATGGTGCCCAGGGAAGGG - Intergenic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1007705108 6:43785707-43785729 GTCTCTCTGTGCCTCGGGAAGGG - Exonic
1016890720 6:149004495-149004517 GGCCCATGGTGCCCCAGGAAGGG + Intronic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1051365409 9:16318251-16318273 GTCCCAAAGAGCCACGAGAAGGG - Intergenic
1053149297 9:35732546-35732568 GTCCCACAGTGCCACGGGGTGGG + Exonic
1055107486 9:72527761-72527783 GGCTCACGGTGCAAGGGGAAGGG + Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1188747940 X:33869906-33869928 GTCCCACGTTGACATGGGACTGG + Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic