ID: 1055629216

View in Genome Browser
Species Human (GRCh38)
Location 9:78205947-78205969
Sequence GGACAATCCTATGCAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055629209_1055629216 26 Left 1055629209 9:78205898-78205920 CCAAAACTACTTTAAATTTCATA No data
Right 1055629216 9:78205947-78205969 GGACAATCCTATGCAAAAAGAGG No data
1055629211_1055629216 -2 Left 1055629211 9:78205926-78205948 CCAAAAGAGCCCGTATAGCCAGG No data
Right 1055629216 9:78205947-78205969 GGACAATCCTATGCAAAAAGAGG No data
1055629208_1055629216 30 Left 1055629208 9:78205894-78205916 CCGGCCAAAACTACTTTAAATTT No data
Right 1055629216 9:78205947-78205969 GGACAATCCTATGCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055629216 Original CRISPR GGACAATCCTATGCAAAAAG AGG Intergenic
No off target data available for this crispr