ID: 1055629916

View in Genome Browser
Species Human (GRCh38)
Location 9:78212875-78212897
Sequence TAGGGAACTCATACTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055629912_1055629916 28 Left 1055629912 9:78212824-78212846 CCTTTTACAGAGGTAACTGGGAG No data
Right 1055629916 9:78212875-78212897 TAGGGAACTCATACTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055629916 Original CRISPR TAGGGAACTCATACTGTTGC AGG Intergenic
No off target data available for this crispr