ID: 1055634480

View in Genome Browser
Species Human (GRCh38)
Location 9:78261859-78261881
Sequence TTAAAGAATTTGTAGTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055634478_1055634480 16 Left 1055634478 9:78261820-78261842 CCCATAAAAACTTGGTTGGCTTT 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG No data
1055634476_1055634480 23 Left 1055634476 9:78261813-78261835 CCTTTTTCCCATAAAAACTTGGT 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG No data
1055634479_1055634480 15 Left 1055634479 9:78261821-78261843 CCATAAAAACTTGGTTGGCTTTA 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055634480 Original CRISPR TTAAAGAATTTGTAGTTATT AGG Intronic
No off target data available for this crispr