ID: 1055636869

View in Genome Browser
Species Human (GRCh38)
Location 9:78287588-78287610
Sequence CTGCTTTTCATGAGAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055636864_1055636869 15 Left 1055636864 9:78287550-78287572 CCAGCATTCCTATAGGGTGGAGG No data
Right 1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG No data
1055636866_1055636869 7 Left 1055636866 9:78287558-78287580 CCTATAGGGTGGAGGAGACTAGG No data
Right 1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG No data
1055636861_1055636869 19 Left 1055636861 9:78287546-78287568 CCACCCAGCATTCCTATAGGGTG No data
Right 1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG No data
1055636863_1055636869 16 Left 1055636863 9:78287549-78287571 CCCAGCATTCCTATAGGGTGGAG No data
Right 1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055636869 Original CRISPR CTGCTTTTCATGAGAAAACA AGG Intergenic
No off target data available for this crispr