ID: 1055638317

View in Genome Browser
Species Human (GRCh38)
Location 9:78298524-78298546
Sequence ACATCTCCACAGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055638317_1055638323 13 Left 1055638317 9:78298524-78298546 CCCTGCTCCAGCTGTGGAGATGT 0: 1
1: 0
2: 1
3: 22
4: 239
Right 1055638323 9:78298560-78298582 CTCCTGCACCCCCCATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638317 Original CRISPR ACATCTCCACAGCTGGAGCA GGG (reversed) Intronic
900351585 1:2237567-2237589 TCCTCTCAACAGCTGGACCAGGG - Intronic
900389039 1:2426171-2426193 ACATCTGCACAGATGGTGAAAGG - Intronic
904858233 1:33515996-33516018 CCATCTGCACAGCGGCAGCAAGG - Exonic
904913269 1:33951150-33951172 ACATCTCCAGGGCTGGAGAGAGG + Intronic
905397748 1:37677930-37677952 ACATCTACTCAGCTGTAACAAGG - Intergenic
910159578 1:84259013-84259035 ACATGTCCACCTCTGGGGCAGGG + Intergenic
914904107 1:151729801-151729823 ACAAAACCACAGCTGAAGCATGG - Intronic
914991791 1:152505148-152505170 GCATCTCCATAGCTGGAGCCTGG - Intergenic
915063046 1:153202620-153202642 AAATCTCCACATCTGAAGGAAGG - Intergenic
915111435 1:153566633-153566655 GCTACTCGACAGCTGGAGCAGGG - Intronic
915120444 1:153627137-153627159 ACCTCTCCTCAGCGGCAGCAGGG + Intronic
916378635 1:164183938-164183960 ACATATCCACTGTTGGAGAATGG - Intergenic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917355582 1:174123521-174123543 ACATCACCAGAGCAGGAGGAAGG - Intergenic
919928769 1:202207944-202207966 TTATCTCCACAGCTGGACCAGGG - Intronic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
921275135 1:213511644-213511666 AGATCTGCATAGCTGGAGAAGGG - Intergenic
922136542 1:222833023-222833045 CCATCTCTTCAGCTGGAGGAGGG + Intergenic
1063001094 10:1923838-1923860 ACTTCTCCCAAGCTGGTGCAGGG + Intergenic
1065139701 10:22708358-22708380 AGATCTCCACCGGAGGAGCAGGG - Intronic
1065145217 10:22761885-22761907 TCATCACCACAGCTGGAGTTAGG + Intergenic
1066696091 10:38078794-38078816 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1066708117 10:38203169-38203191 ACAGGTCCACAGCTGGGACATGG - Intergenic
1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG + Intronic
1069914157 10:71776903-71776925 ACATCTTCCCAGGTGGAGAAAGG + Intronic
1070714881 10:78712367-78712389 ACATGTCCACTCCTGGAGCTGGG - Intergenic
1071482850 10:86078162-86078184 TCATCTCCACAGCTAGAAGAGGG + Intronic
1071860177 10:89664380-89664402 ACCTCTCCAGAGCCGCAGCAAGG - Intergenic
1074511476 10:114116555-114116577 ACAGCTCCAGACCTAGAGCAAGG + Intergenic
1075581978 10:123625700-123625722 ACATCTGGACAGCTGGAGACAGG + Intergenic
1075856550 10:125634971-125634993 ACATTTCCTCAGCTGGGGCCAGG + Intronic
1075862675 10:125690670-125690692 CCAGGTCCACAACTGGAGCAGGG - Intergenic
1075901063 10:126043196-126043218 GCATCACCACAGCAGAAGCAAGG + Intronic
1076032814 10:127173988-127174010 GCCTCTCCACTGCTGGAGCTGGG + Intronic
1076228829 10:128803105-128803127 ACTTCTCCACTACTGGACCAGGG - Intergenic
1076495246 10:130892996-130893018 AGATTGCCACAGCTGGACCAAGG + Intergenic
1079244157 11:18740995-18741017 ACATCTCCACTGCAGGAGGCAGG - Intronic
1081243164 11:40731371-40731393 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1081603966 11:44515228-44515250 AAATGTCCCCAGCTGGGGCAAGG + Intergenic
1085295014 11:75426576-75426598 CCATCTGCACACCTGGATCAAGG - Exonic
1088547016 11:110969318-110969340 ACATTTCCACAGTGGAAGCATGG - Intergenic
1088938913 11:114434279-114434301 ACATGGCCAGAGCAGGAGCAAGG + Intronic
1090920109 11:131199339-131199361 AGATCTCCTGAGGTGGAGCAAGG + Intergenic
1091364726 11:135008133-135008155 ACAGCTCCACAGCTGGACTTTGG + Intergenic
1091510758 12:1123024-1123046 CCATCTCACCAGCTGGAGCTGGG - Intronic
1091658322 12:2362227-2362249 ACATCTCCAGTGTTGTAGCATGG + Intronic
1092333064 12:7603281-7603303 ACATCATCCCAGCTGGAGCAGGG - Intergenic
1093493209 12:19727003-19727025 CCATCACAACAGCTGCAGCAGGG - Intergenic
1094144376 12:27213893-27213915 CCATCACCCCAGCTGCAGCAGGG + Intergenic
1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG + Intergenic
1097861425 12:64522336-64522358 ACATCCCCCCAGCAGGAGCTGGG - Intergenic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1101155612 12:101924874-101924896 ACATGTTCACCTCTGGAGCAGGG + Intronic
1101399545 12:104375575-104375597 TCATCTCCACAGCTCTGGCATGG + Intergenic
1101469445 12:104982963-104982985 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1102249960 12:111380042-111380064 ACATCTCAGCAACTTGAGCAGGG + Intergenic
1102675166 12:114652945-114652967 ACATCACCATAGCTAGAACACGG - Intergenic
1109971418 13:69775238-69775260 ACATCTAAAGAGATGGAGCAAGG + Intronic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1112894845 13:104286215-104286237 ACAAGTCCAGAGCTGGATCAGGG - Intergenic
1113232342 13:108226718-108226740 ACATCTCAGCAGATGGTGCATGG + Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1117504558 14:56389162-56389184 ACATGGCCACTGCTGGAGGATGG + Intergenic
1118369515 14:65125535-65125557 GCATAGCCAGAGCTGGAGCAAGG + Intergenic
1120002515 14:79318572-79318594 ACATGACAACAGCTGGAGAATGG - Intronic
1120235327 14:81883636-81883658 GCATCTCCACATCTGTCGCAGGG + Intergenic
1124132183 15:27000647-27000669 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1124620534 15:31271527-31271549 ACTTAGCCACGGCTGGAGCATGG + Intergenic
1127335644 15:57980529-57980551 AGAGCTTCACAGCTGGATCAAGG - Intronic
1128384100 15:67134980-67135002 ACATCTCCCCAGCAGGACCCTGG - Intronic
1129255811 15:74333354-74333376 GCATCTTCAGAGGTGGAGCAGGG - Intronic
1129681217 15:77659505-77659527 CCATGTCCACAACTGGAACATGG - Intronic
1132075420 15:98816006-98816028 ACCTCCCCACAGCTTGAGTATGG - Intronic
1132386865 15:101407005-101407027 CCATCTCCACAGCTGTGTCACGG + Intronic
1133537350 16:6714732-6714754 GCATCTACACAGCTGGGACATGG + Intronic
1135039368 16:19106135-19106157 GAAACTCCGCAGCTGGAGCAGGG - Intergenic
1136933200 16:34436747-34436769 GCATCTTCCCAGCAGGAGCAGGG + Intergenic
1136971372 16:34975067-34975089 GCATCTTCCCAGCAGGAGCAGGG - Intergenic
1137540817 16:49360413-49360435 TCATCACCACAGCTGGAGCAGGG - Intergenic
1139692813 16:68651838-68651860 AGAGCTCCACAGCTGGATCGAGG - Intronic
1140078435 16:71723303-71723325 ACATCACCCCAGCGGGAGGATGG - Intronic
1140281189 16:73556687-73556709 ACATCACCTCAGCTTGAGCTAGG - Intergenic
1142217150 16:88835373-88835395 GCATCTCCATACCTGGAGGATGG + Intronic
1143167295 17:4903196-4903218 AAATGTCCCCAGCTGCAGCAGGG - Intergenic
1143285956 17:5789501-5789523 ACTGCTCCACAGCGGCAGCACGG - Intronic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1144413389 17:15022669-15022691 ACATCTCCATGTCTGGAGAAGGG - Intergenic
1144835817 17:18156184-18156206 ATATCTGCAAAGCTGGAGGATGG - Exonic
1146450710 17:32971850-32971872 ACATCATCCCAGCTGGGGCAGGG - Intronic
1146904549 17:36609620-36609642 AAATCTCCCCTCCTGGAGCATGG + Intergenic
1151902223 17:77023940-77023962 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1152104817 17:78322863-78322885 ACATGTCCACAGCTGGGGGTGGG - Intergenic
1152282606 17:79394368-79394390 CCATCTCCACCACTGGGGCAGGG + Intronic
1153163534 18:2236741-2236763 ACATCTTCCCAGCTGTAGCTGGG + Intergenic
1153311607 18:3682218-3682240 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1157275020 18:46304232-46304254 CCCTCCCCACAGCTGGAGCAAGG - Intergenic
1157506548 18:48230641-48230663 ACATCATCACATCTGGTGCAAGG + Intronic
1157651012 18:49331078-49331100 ACATTTCCACAGCTGCATTATGG - Intronic
1157819249 18:50753486-50753508 ACAACTACACAGCTGGTCCATGG + Intergenic
1158530736 18:58257586-58257608 ATTTCTCCACAGCTGGAGACAGG - Intronic
1159143342 18:64423733-64423755 ACATCTCCATTGCTGAAGAAAGG + Intergenic
1161456180 19:4370737-4370759 ACATGTCCCCGCCTGGAGCAGGG + Intronic
1161981783 19:7633765-7633787 GCATCCCCACAGTTGGAGAAGGG + Intronic
1162178282 19:8847800-8847822 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1162438393 19:10677587-10677609 ACTTCTCCACAGCCAGAGAATGG - Intronic
1163834895 19:19567260-19567282 ACAAGGCCAGAGCTGGAGCAAGG - Intronic
1163953539 19:20613119-20613141 GCATTTGCACAGCTTGAGCATGG - Intronic
1166312669 19:41971589-41971611 ACAACTCCACAGCTGGACCTTGG + Intronic
1168409116 19:56127565-56127587 ACATGTCCACTCCTGGAGCAGGG + Intergenic
925675842 2:6360301-6360323 GCATCTCCACTGCTGGGACAGGG + Intergenic
927185618 2:20480045-20480067 AGTTATCCCCAGCTGGAGCATGG - Intergenic
927353897 2:22151617-22151639 ACAACCACACAGCTGGAGGAAGG - Intergenic
928359501 2:30651589-30651611 TCAACTCCACAGCTGTAACACGG + Intergenic
928411881 2:31060667-31060689 ACATCACCCCAGCTGCACCATGG - Intronic
929038735 2:37722554-37722576 GCATCTCTACTGGTGGAGCAAGG + Intronic
929786729 2:44998977-44998999 ATATCTCCGCAGGTGGAGAAGGG + Intergenic
931231726 2:60380821-60380843 ACAGCCCCACAGATGGAGCTGGG - Intergenic
932438490 2:71717105-71717127 ACAATTGCACAGCTGGAGCAGGG - Intergenic
933398905 2:81766190-81766212 CCATCTTCACAGCTGCAGAATGG - Intergenic
933850715 2:86364542-86364564 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
934488169 2:94737432-94737454 AGAGCTCCGCAGCTGGATCAAGG + Intergenic
934538195 2:95154118-95154140 ACATCGCCCCACCTGGGGCAGGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937465215 2:122126366-122126388 ACATGTCCAGAGCAGGAGGAAGG - Intergenic
937963699 2:127484512-127484534 ACTTCCCCATAGGTGGAGCAGGG - Intronic
938152312 2:128897956-128897978 ACATATCCACAGCTGGACTGAGG + Intergenic
938259840 2:129887792-129887814 ACATCACCACACCTAGAGTAGGG + Intergenic
939632971 2:144547533-144547555 ACATCTGCAAAGCTGGTCCAAGG - Intergenic
940738762 2:157482790-157482812 ACATCTCAGCAGCAGGAGCTGGG + Intronic
942134251 2:172909580-172909602 ACACCTCCACAGCCGGAGTGTGG + Intronic
943016992 2:182525554-182525576 ACATGACCACAGCAGGAGGATGG - Intergenic
943375789 2:187075174-187075196 ACACTTGCACAGCTGGAGGATGG - Intergenic
945754352 2:213828905-213828927 AGCTGTCCACAGCTGGAGGATGG + Intronic
948175271 2:235938207-235938229 TCATCTCCTCATCTGAAGCAGGG - Intronic
1170769550 20:19320001-19320023 ACTTCTCAGCAGCTGCAGCATGG + Intronic
1172931628 20:38590801-38590823 AAAGCTCATCAGCTGGAGCAAGG - Intergenic
1173909738 20:46657805-46657827 ACATGTCCAGAGCAGGAGCAAGG + Intronic
1175533693 20:59692318-59692340 ACACCTCCAGAGCTGAACCACGG - Intronic
1176087490 20:63304612-63304634 ACATCTGCGCAGCTGGAGGGAGG - Intronic
1176265764 20:64208532-64208554 GCATCTGCACACCTGGGGCAGGG - Intronic
1176637789 21:9264746-9264768 TCATCACCACAGCTGAAACAAGG + Intergenic
1177162269 21:17560456-17560478 ACACAGCCTCAGCTGGAGCAGGG - Intronic
1180421829 22:12872243-12872265 TCATCACCACAGCTGAAACAAGG + Intergenic
1181199048 22:21207191-21207213 ACAGCCCAACACCTGGAGCAGGG - Intergenic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1182303274 22:29350713-29350735 ACATCTCCACAGACAGAGAAAGG + Intronic
1182397542 22:30047076-30047098 AGAGCTCCACAGCTGGATCAAGG - Intergenic
1182424855 22:30266563-30266585 GCATCTCCACAGGTAGAGAAGGG - Intronic
1183000778 22:34856916-34856938 CCAGCTTCACAGCTTGAGCAAGG + Intergenic
1183493740 22:38130063-38130085 ACATTTCCACACCTGGAGGCCGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184050379 22:41999447-41999469 ACATCTCCCTGGTTGGAGCAAGG - Intronic
1185149718 22:49157196-49157218 CCGTCTCCACAGCTGGAAGAAGG - Intergenic
949554714 3:5143012-5143034 ACATCATCCCAGCTGGGGCATGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950523794 3:13511680-13511702 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
952206134 3:31182562-31182584 AGAGCTCCACAGCTGGATCGAGG - Intergenic
953128622 3:40115983-40116005 ACAACTGCACAGCACGAGCAAGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954196562 3:49000605-49000627 ACACTTCCAGAGCAGGAGCATGG - Intronic
955050443 3:55405571-55405593 ACATCACTGCAGCTGGAGCCAGG + Intergenic
959583931 3:108008532-108008554 CCATCTCCACGGCCGTAGCAGGG + Intergenic
961450148 3:126999034-126999056 ACCTGTCCACAGCTGGAGGAGGG + Intronic
966631698 3:182083216-182083238 AAATCCCCACATCTGCAGCATGG - Intergenic
967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG + Intergenic
1202749106 3_GL000221v1_random:140275-140297 TCATCACCACAGCTGAAACAAGG - Intergenic
968619669 4:1598167-1598189 ACCTCCCCACAGCCGGAGAAGGG - Intergenic
968976822 4:3826368-3826390 AAATCTCCGAAGCTGGTGCAGGG - Intergenic
969396423 4:6924599-6924621 ACACCTCCACAGCAGAGGCAGGG - Intronic
970857177 4:20662292-20662314 ACATGGCCACACCTGCAGCAAGG + Intergenic
971460965 4:26896021-26896043 CCATGTCCTCATCTGGAGCATGG + Intronic
973095856 4:46198527-46198549 AGATCACCAAAGCTGGAGTAAGG + Intergenic
981542522 4:145860568-145860590 TTATCTCCACAGCTGGAGAGAGG - Intronic
985145677 4:186892100-186892122 CCAGCTCTACAGCTGGAGCTTGG + Intergenic
1202752687 4_GL000008v2_random:23162-23184 TCATCACCACAGCTGAAACAAGG + Intergenic
985630243 5:1010095-1010117 ACATCTGCACAGCTGTGGCAAGG + Intronic
985801297 5:2006798-2006820 ACATCTCCACATTTGGTGTAGGG + Intergenic
985923177 5:2995488-2995510 ACATCCCCACAGCTGGTCCCGGG + Intergenic
986339875 5:6779802-6779824 CCATCACCAGAGCTGGAGGAGGG + Intergenic
986831558 5:11585106-11585128 ACATTTCCATAGCTGGAGGGTGG + Intronic
988827419 5:34951950-34951972 ACTTCTTCACAGCTGCAGAATGG + Intronic
989608784 5:43272058-43272080 ACATGTCCTCAGCTGGTGAATGG - Intronic
990012568 5:51018182-51018204 ACATGTCCATTACTGGAGCAAGG - Intergenic
990447248 5:55904391-55904413 ACATCTCCAAGGCTCCAGCAGGG + Intronic
994584602 5:101690533-101690555 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
996385386 5:122905101-122905123 ACATCTACACAGCTGGAGTGTGG - Intronic
998477376 5:142433140-142433162 GCATCTCCACACCTGCAGCATGG - Intergenic
1001180383 5:169514589-169514611 TCATCTCCACAGCTGGAGGGAGG - Intergenic
1002607298 5:180390777-180390799 ACATGTCCACAGCTGGATGGTGG + Intergenic
1002716882 5:181233625-181233647 ACCTCTTCACACCTGGAGGAAGG - Exonic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1003389835 6:5704033-5704055 CCATCTCCACTGCTGTAGGAAGG - Intronic
1003447996 6:6202400-6202422 ACATCTCCAGCACTAGAGCAGGG + Intronic
1003687113 6:8315181-8315203 ACTTCTCCACTGCTAGAGCCAGG - Intergenic
1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG + Intergenic
1004163619 6:13236131-13236153 TCATCACCTGAGCTGGAGCAGGG + Intronic
1004858986 6:19781765-19781787 AGGTCACCACAGCTGGAGCAGGG - Intergenic
1007581835 6:42964459-42964481 TCATCTCCAGGGCTGGAGCCAGG - Exonic
1011714020 6:90085454-90085476 GCAGCCCCACTGCTGGAGCATGG + Intronic
1012089772 6:94876269-94876291 AAATCTCCAGAGCAGGACCAGGG - Intergenic
1012716603 6:102681084-102681106 AGCTCTCCACAACTGGAGAAAGG - Intergenic
1014558047 6:122856814-122856836 ACATGGCCACAGCAGGAGCAAGG + Intergenic
1014758177 6:125325030-125325052 AAATCTCCACGGGTGAAGCAAGG + Intergenic
1015450489 6:133361874-133361896 ACATCTCCATGCCTGGAACAGGG - Intronic
1015717856 6:136210648-136210670 AAGTCTCCACAGCTGGTGGAAGG + Intergenic
1015753148 6:136581552-136581574 CCATCTCCCCAGCTGCAGTAGGG - Intronic
1016700374 6:147047698-147047720 ACATAGCGAGAGCTGGAGCAAGG - Intergenic
1017019508 6:150129035-150129057 ACACCTCCCCAGCTGTAGCTAGG - Intergenic
1017511715 6:155120030-155120052 ACATCCCAACATCTGCAGCATGG - Intronic
1018915678 6:168131060-168131082 TCATCTCCTCAGCAGCAGCACGG + Intergenic
1019659762 7:2217620-2217642 ACAGTTGCACAGCTGGAGCTGGG - Intronic
1021580184 7:22144079-22144101 ACAGCTCCCCAGCAGAAGCAGGG - Intronic
1022331285 7:29381719-29381741 AAATCTCCAGGGCTGGAGCCAGG - Intronic
1022499314 7:30872654-30872676 TCATCTCCCCAGCTGGACCCAGG - Intronic
1023628081 7:42136662-42136684 ACAACCCAACACCTGGAGCACGG + Intronic
1023760449 7:43460900-43460922 ACATGTCCTCAGCTGGACCTTGG - Intronic
1027525645 7:79266097-79266119 GTATCTCCAGAGCTGGAGGATGG + Intronic
1028267810 7:88749430-88749452 AGATCTCCTCAGCTGTAGCTGGG - Intergenic
1028667016 7:93357360-93357382 ACATTTCCCCAGCAGCAGCAGGG + Intronic
1029421576 7:100474583-100474605 CCTTCTCCAGAGCTGGAGGAGGG - Intronic
1029576808 7:101408775-101408797 AGATCTGCACAGCCGCAGCAAGG - Intronic
1031710075 7:125034429-125034451 CCATCTCCTCCTCTGGAGCAGGG - Intergenic
1034939443 7:155220842-155220864 ACATCCCCAGTGCTGGAGCTGGG - Intergenic
1035039332 7:155916186-155916208 ACATCTGCATGGCTGGAGAAGGG - Intergenic
1035834391 8:2732948-2732970 ACATCTCCTCATCTAGACCATGG - Intergenic
1036717788 8:11142606-11142628 ACATGGCAAGAGCTGGAGCAAGG - Intronic
1037842054 8:22251781-22251803 ACGTCTCCCCAGCTGAACCAGGG - Exonic
1043533498 8:81175580-81175602 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1043985214 8:86686792-86686814 ACAGTACCACAGCTGGAGAAAGG + Intronic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1046720998 8:117619049-117619071 ACATCTCCACAGCTAGTGAGTGG + Intergenic
1048345757 8:133572976-133572998 ATCTCTCTCCAGCTGGAGCAAGG - Intergenic
1048378657 8:133844917-133844939 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1048635575 8:136291827-136291849 ACATAGCCAGAGCAGGAGCAAGG + Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1051123504 9:13777575-13777597 ACATCTTTACAGTTGGAGCTTGG - Intergenic
1052093873 9:24361679-24361701 ACATGGCCACTGCTGGAGAATGG - Intergenic
1053599423 9:39595239-39595261 ACATCCTCAAGGCTGGAGCAGGG + Intergenic
1053669620 9:40346932-40346954 AGAGCTCCGCAGCTGGATCAAGG - Intergenic
1053857128 9:42349424-42349446 ACATCCTCAAGGCTGGAGCAGGG + Intergenic
1053919416 9:42973172-42973194 AGAGCTCCGCAGCTGGATCAAGG - Intergenic
1054254102 9:62747148-62747170 ACATCCTCAAGGCTGGAGCAGGG - Intergenic
1054380753 9:64486952-64486974 AGAGCTCCGCAGCTGGATCAAGG - Intergenic
1054514994 9:66029359-66029381 AGAGCTCCGCAGCTGGATCAAGG + Intergenic
1054568165 9:66781310-66781332 ACATCCTCAAGGCTGGAGCAGGG - Intergenic
1054809268 9:69421959-69421981 GCTTCTCCCCAGCTGGAGGAAGG + Intergenic
1054968569 9:71058381-71058403 ACAGCTGCACAGCTGCAGGAGGG + Intronic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1056160447 9:83886050-83886072 ACATCTGCATAACTGGAGCTAGG - Intronic
1056743058 9:89276607-89276629 ACCTCTTCAGAACTGGAGCAAGG - Intergenic
1057218326 9:93241994-93242016 ACCTCACCACAGCTGTAGGATGG + Intronic
1060316343 9:122514916-122514938 ATATCTCCGCAGGTGGAGCTGGG + Intergenic
1060884537 9:127141091-127141113 AAATCTCCACCGCTGCAGAAAGG - Intronic
1061310669 9:129760148-129760170 ACAGCCCCACAGCTAGAACAGGG - Intergenic
1203717746 Un_KI270742v1:170365-170387 TCATCACCACAGCTGAAACAAGG - Intergenic
1186080035 X:5921046-5921068 ACATCTTCATTGCTGAAGCATGG + Intronic
1190877381 X:54469779-54469801 ACTTCTCAACAGCTGGAGGAGGG - Intronic
1192679834 X:73241180-73241202 ATATCACCACTGCTGGAGGATGG - Intergenic
1199286378 X:146059160-146059182 ACTCCTCCATGGCTGGAGCATGG + Intergenic
1201863058 Y:18620814-18620836 TCATTTTTACAGCTGGAGCAAGG + Intergenic
1201870265 Y:18699564-18699586 TCATTTTTACAGCTGGAGCAAGG - Intergenic
1202193359 Y:22268824-22268846 ACATCTCTAAATCAGGAGCAAGG - Intergenic