ID: 1055638910

View in Genome Browser
Species Human (GRCh38)
Location 9:78304220-78304242
Sequence AAAGCAGAGCCAGAAGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 1, 2: 5, 3: 51, 4: 527}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055638910_1055638915 -1 Left 1055638910 9:78304220-78304242 CCCCCATCTTCTGGCTCTGCTTT 0: 1
1: 1
2: 5
3: 51
4: 527
Right 1055638915 9:78304242-78304264 TCTTATGTGTTCTCTTCATTGGG No data
1055638910_1055638914 -2 Left 1055638910 9:78304220-78304242 CCCCCATCTTCTGGCTCTGCTTT 0: 1
1: 1
2: 5
3: 51
4: 527
Right 1055638914 9:78304241-78304263 TTCTTATGTGTTCTCTTCATTGG No data
1055638910_1055638916 2 Left 1055638910 9:78304220-78304242 CCCCCATCTTCTGGCTCTGCTTT 0: 1
1: 1
2: 5
3: 51
4: 527
Right 1055638916 9:78304245-78304267 TATGTGTTCTCTTCATTGGGTGG No data
1055638910_1055638917 12 Left 1055638910 9:78304220-78304242 CCCCCATCTTCTGGCTCTGCTTT 0: 1
1: 1
2: 5
3: 51
4: 527
Right 1055638917 9:78304255-78304277 CTTCATTGGGTGGCCACCATTGG No data
1055638910_1055638918 19 Left 1055638910 9:78304220-78304242 CCCCCATCTTCTGGCTCTGCTTT 0: 1
1: 1
2: 5
3: 51
4: 527
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638910 Original CRISPR AAAGCAGAGCCAGAAGATGG GGG (reversed) Intronic
900218787 1:1496012-1496034 ACAGCAGAGCCAGGTGAGGGGGG + Exonic
901286512 1:8083740-8083762 GAATCAGACCCAGAAGGTGGAGG - Intergenic
902118827 1:14144242-14144264 AACGCAGAGCAAAAAGATGAAGG - Intergenic
902150612 1:14439984-14440006 AAAGTAGAGCCAGAACAGTGGGG - Intergenic
903300811 1:22377372-22377394 AAAGCAGAGCCAAAGGCTGTAGG + Intergenic
903960718 1:27055758-27055780 AAAACAGAGACAGAAGAGTGAGG + Intergenic
904513595 1:31035452-31035474 GAAGCAAAGCAAGAAGTTGGTGG + Intronic
904686666 1:32265822-32265844 AAAGAAGAGGAAGAAGAAGGAGG - Intronic
905705177 1:40050904-40050926 CAAGCTGGGCCAGATGATGGAGG - Intronic
906900945 1:49835901-49835923 AAGCCAGAACCAGAAGAGGGTGG - Intronic
907124386 1:52036493-52036515 ATGGCAGAGGCAGAAGAGGGTGG + Intronic
907446848 1:54513661-54513683 AAAGCAAAGCCTGACGAAGGTGG + Intergenic
907490397 1:54805659-54805681 CAAGGAGAGCCAGAGGGTGGAGG - Intergenic
907675163 1:56511218-56511240 AAAGCAGTGCCTACAGATGGAGG + Intronic
908233493 1:62128636-62128658 AAATCAGAGCAACAAGAAGGGGG - Intronic
908418626 1:63937673-63937695 AAATCAGAGCCTGAAGGTGCAGG + Intronic
908420255 1:63952320-63952342 AAAGCAGAACTAGGTGATGGAGG + Intronic
908751638 1:67429963-67429985 AAAGCAGGGGCAGAATGTGGGGG - Intronic
908800549 1:67875645-67875667 AAAGCAGGGCCAGAAGATGCGGG + Intergenic
909236823 1:73163137-73163159 CAAGAAGAGAGAGAAGATGGAGG - Intergenic
909651297 1:77978958-77978980 CCAGCTGAGCCAGAAGAGGGGGG + Exonic
910050903 1:82973223-82973245 AAGGCAGAGACAGAAGCTGCTGG + Intergenic
910408532 1:86915120-86915142 AAACCAGATCCAGAAACTGGAGG + Exonic
911184155 1:94886615-94886637 AGAGCAGAACCACAAGCTGGAGG - Intronic
911715439 1:101127416-101127438 TAAACAGGGCCAGAAAATGGGGG + Intergenic
911801676 1:102147388-102147410 GAAGAAGAGCCAGATGATTGAGG + Intergenic
912069576 1:105792849-105792871 AAAGAAGAGGCAGAAGAAGTAGG - Intergenic
912708760 1:111934428-111934450 AAACCAGAGCTAGGAGATGCTGG + Intronic
912809058 1:112780060-112780082 TAGGCAGAGCCAGATGTTGGGGG - Intergenic
912858580 1:113193057-113193079 AAACCAGAGCCAGATCATGAAGG - Intergenic
913073990 1:115325683-115325705 ACAGCAGAGGCAGGAGATGCAGG + Intronic
913241291 1:116832176-116832198 AGAGGAGACTCAGAAGATGGTGG - Intergenic
913423471 1:118699586-118699608 CAAACAGTGCCAGAAGATGAGGG + Intergenic
914704788 1:150161730-150161752 CCAGGGGAGCCAGAAGATGGAGG + Intronic
914998440 1:152565233-152565255 GAAGCAGAATCAAAAGATGGAGG - Intronic
915001787 1:152600825-152600847 AGAGCACAGTCAGAAGAGGGTGG - Exonic
915083689 1:153369787-153369809 AGGGGAGAGCCTGAAGATGGGGG - Intergenic
915468181 1:156110135-156110157 AAAGCAGAGGCTGAGCATGGTGG - Intronic
916611570 1:166396865-166396887 AAAGCAGGGCCAGAGAAGGGAGG + Intergenic
916651106 1:166835574-166835596 GAAGCAGAAGCAGAAGAAGGAGG - Intergenic
917655319 1:177120105-177120127 GCATCAGAGCCAGAAAATGGAGG + Intronic
918037392 1:180888006-180888028 AGAGAAGAGCAAGAAGATGTTGG + Exonic
918138626 1:181700915-181700937 AAAGAAGAGCCAAAATATGAGGG - Intronic
918149436 1:181785391-181785413 GAAGCAGAGGCAGCAGCTGGAGG + Exonic
918350630 1:183652263-183652285 AAAACAGCCACAGAAGATGGGGG - Intronic
918578493 1:186095431-186095453 AAAGCAGAGACTGAAGATTCGGG + Exonic
919269180 1:195316776-195316798 AGCACAGAGCCGGAAGATGGGGG - Intergenic
919424091 1:197407171-197407193 AAAGCAAAGACAAAATATGGAGG + Intronic
919742762 1:200990701-200990723 AAAGAAGTTCCAGAAGAAGGGGG - Exonic
920180961 1:204131469-204131491 AAAGCAGAGCCAGGCTCTGGAGG + Exonic
920336488 1:205248701-205248723 AAAGAAGAGGGAGAAGAGGGTGG - Intronic
922891433 1:229064876-229064898 GGAACAGAGCCAGATGATGGGGG + Intergenic
923057219 1:230435984-230436006 AAGACAAAGCCAGAAGATGAAGG - Intergenic
923268521 1:232334753-232334775 GAAGGAGAGCCAGAAGATGAGGG - Intergenic
923720157 1:236459978-236460000 AAAGCACAGACAGAAGAGGAAGG - Intronic
924853619 1:247855401-247855423 CAAGCTGGGCCAGAATATGGTGG - Intergenic
1063903081 10:10755459-10755481 GTAGCAGAGCCAGTAGATGAAGG - Intergenic
1064836175 10:19533639-19533661 AAAGCAGAGGCAAAAGAGGGAGG + Intronic
1065702966 10:28443423-28443445 AAAGAAGAACCTGCAGATGGAGG + Intergenic
1065747452 10:28855302-28855324 AAAGGAGGGCCATAAGCTGGAGG - Intronic
1065761933 10:28990657-28990679 AAAGCAGGGCCAAAAGAAGGAGG - Intergenic
1067163146 10:43843824-43843846 AAAGCAGGGCAAGAAGACAGAGG - Intergenic
1067528449 10:47052581-47052603 ACAGCAAGGCCAGAAGAGGGAGG + Intergenic
1067749912 10:48964164-48964186 AAAGCACAGGAAGATGATGGGGG - Intronic
1068720247 10:60237281-60237303 AGAGCTGAGACAGCAGATGGAGG + Intronic
1069510367 10:69037654-69037676 AAAGCAGAGCCCGGAGATGCAGG + Intergenic
1070401951 10:76060571-76060593 AAAGCAGAGAGAGAAGAGTGTGG - Intronic
1072190737 10:93074517-93074539 CAAGCAGCGCAAGAAGGTGGGGG + Exonic
1073052215 10:100674706-100674728 GAACCAGAGTGAGAAGATGGGGG - Intergenic
1073383724 10:103103808-103103830 AAAGAAGAGACTGAAGATAGAGG - Intronic
1074051188 10:109882633-109882655 AATGAAGAGCCTGCAGATGGAGG + Exonic
1074407765 10:113193870-113193892 AAAGCAGGGCCATATGATAGTGG + Intergenic
1074541184 10:114366476-114366498 AAACCCGAGCCTGAAGAAGGAGG + Intronic
1074564536 10:114565357-114565379 AAAGCAGAGTCACAAAATGTGGG + Intronic
1074936624 10:118188279-118188301 AAAGAGGGGCCAGAAGATGCTGG + Intergenic
1076255648 10:129022466-129022488 AGAGGAGAGCCAGGAGGTGGTGG + Intergenic
1076606607 10:131693633-131693655 AAGGCAGAGCCAGGAGCTTGGGG + Intergenic
1076672907 10:132132946-132132968 ACAGCAGAGTCAGGAGCTGGAGG + Intronic
1076771914 10:132670459-132670481 AGAGGAGAGGCTGAAGATGGGGG - Intronic
1077010738 11:378159-378181 AAGGCAGGGGCAGAGGATGGAGG + Intronic
1077578160 11:3399895-3399917 GAAGCAGAACCACAAGATGGAGG + Intergenic
1078416369 11:11169716-11169738 AAATCAGAGCCTGGAGAGGGTGG - Intergenic
1078461989 11:11521145-11521167 AAAAGAGAGCCAGGAGGTGGTGG - Intronic
1078840338 11:15071955-15071977 GAAGCAAAGCCAGAGGCTGGCGG - Intronic
1080782210 11:35440132-35440154 ACAGCAGAGAAAGAACATGGAGG - Intronic
1080795030 11:35555260-35555282 AGGGCAGAGCCACCAGATGGAGG + Intergenic
1080807234 11:35664305-35664327 AAAGGAGGGTAAGAAGATGGAGG + Intronic
1083514351 11:63242917-63242939 AGGGCAGAGACAGAAGGTGGAGG - Intronic
1083773809 11:64883412-64883434 AAGGCAGGGCCAGAAGCTGCAGG - Intronic
1084067555 11:66713948-66713970 GGAGCAGAACCAGAACATGGGGG - Intronic
1084222191 11:67689275-67689297 AAAGTGGTGTCAGAAGATGGAGG - Intergenic
1084267797 11:68013874-68013896 CAATCAGAGCAGGAAGATGGTGG + Intronic
1084274312 11:68043883-68043905 ACAGCAGAGCCAGGAGCTGCAGG + Exonic
1084682148 11:70672656-70672678 AAAGCAGAGAGAAAAGCTGGAGG - Intronic
1084694774 11:70746691-70746713 AAAGGGGAGCAACAAGATGGAGG - Intronic
1084860285 11:72013704-72013726 AGAGAAGAGCCAGAAGCTGGAGG - Exonic
1084860610 11:72015543-72015565 AGAGCTGAGCCGGAAGGTGGAGG - Exonic
1084981020 11:72828849-72828871 ACAGCAGAGCAAGAAAACGGGGG - Intronic
1085627929 11:78087945-78087967 AAAACAGGCCCAGAAGATTGTGG - Intergenic
1085750769 11:79159125-79159147 AATGCAGAGCTATAAGAGGGGGG + Intronic
1086190758 11:84075973-84075995 AACTCAGAGCCTGAGGATGGTGG + Intronic
1086512580 11:87575149-87575171 ATGGCAGAGACACAAGATGGAGG - Intergenic
1086774727 11:90816112-90816134 AAAACAGAGACAGAGGATGGAGG + Intergenic
1087977581 11:104568811-104568833 AAAACAAAGCCAGAACCTGGTGG - Intergenic
1088487584 11:110355566-110355588 AGAGCAGAGCCAGAAGACGTGGG + Intergenic
1088596855 11:111447642-111447664 AGAGCAGAGGCGGCAGATGGAGG + Intronic
1089364044 11:117910155-117910177 AGAGCAGAGCCACCACATGGTGG + Intronic
1089495233 11:118904871-118904893 AGAGCAGAGCCAGAAATTTGCGG + Intronic
1089639662 11:119839359-119839381 AAAGAAGAGAAAGAAGGTGGAGG - Intergenic
1089657757 11:119964031-119964053 AAAGCAAGGCAAGAAGATGGAGG + Intergenic
1090281270 11:125458167-125458189 AAAGCAGAGGCAGAATCTGGAGG - Intronic
1090485904 11:127111872-127111894 AAATTAGAGCAAGAAGTTGGGGG + Intergenic
1090671984 11:128954549-128954571 ACAGCAGAGGCTGAGGATGGAGG + Intergenic
1093195841 12:16128871-16128893 AAAGCAGTGCCTGGACATGGAGG + Intergenic
1093849186 12:24015455-24015477 AAAGCAAAGCTGGAAAATGGTGG + Intergenic
1093914762 12:24788991-24789013 GGAGCAGAGTCAGAAGATGTGGG - Intergenic
1094365743 12:29678505-29678527 GATGCAGAGCCACAAGATTGAGG + Intronic
1094659770 12:32457857-32457879 AGAGCAGAGCTAGAAGATCAAGG - Intronic
1096841896 12:54384916-54384938 AAAGCAAAACCAGAAGAAGAGGG - Intronic
1098137500 12:67417932-67417954 GAAGCAGAGCCTGAAGATGAAGG + Intergenic
1098162498 12:67658606-67658628 GAAGCTGAGCTAGAAGGTGGAGG - Exonic
1098513321 12:71344763-71344785 AAAGAAGAGGAAGAAGAAGGAGG + Intronic
1099499099 12:83389293-83389315 AAGGCAGAGACAGAAGCTGCTGG + Intergenic
1100333929 12:93611969-93611991 AAAGTATAACCAGTAGATGGGGG - Intergenic
1100818614 12:98409724-98409746 AAGACAGACCAAGAAGATGGGGG - Intergenic
1101001292 12:100360830-100360852 ACAGCAGATCCAGAAGTTGCTGG - Intronic
1101055755 12:100911715-100911737 AGAGCAGTACCAGAAGATGTGGG + Intronic
1101442229 12:104712480-104712502 AACACACAGCTAGAAGATGGTGG + Intronic
1102558507 12:113745620-113745642 AGAGCAGAGCCAAGAGATGGTGG - Intergenic
1102891545 12:116562213-116562235 AAAGCAGAGATAAAAGATAGTGG + Intergenic
1102952601 12:117040544-117040566 AATGAAGAGCTAGAAGGTGGAGG - Intronic
1103050882 12:117778602-117778624 GATGCAGAGCCAGAAGAGGCAGG - Intronic
1103235344 12:119368062-119368084 AAAGAAGAACAAGAAGAAGGAGG + Intronic
1104247851 12:127060606-127060628 AAGGCAGAGACAGAAGCTGCTGG + Intergenic
1104486825 12:129158594-129158616 AATGAAGAGGCAGAGGATGGAGG + Intronic
1105486191 13:20835154-20835176 AAAGTAGAGGCAGCACATGGTGG - Intronic
1106253704 13:28002824-28002846 AAAGAAGAGGCAGAATTTGGTGG + Intergenic
1106329982 13:28731075-28731097 AAAGCAGATATAGAAGATGTAGG - Intergenic
1108422149 13:50261948-50261970 AAAGCAGAACCAAGGGATGGAGG + Intronic
1108864109 13:54901298-54901320 AAAGAAGAGACAAAAGAGGGAGG + Intergenic
1109251104 13:60021738-60021760 AAAGAAGAGCCAAAAAATGTAGG + Intronic
1109377921 13:61522832-61522854 GATGGAGAGCCAGAAGGTGGAGG + Intergenic
1109619291 13:64880299-64880321 AAGGCAGAGACAGAAGCTGCTGG - Intergenic
1110487159 13:76059890-76059912 AAAGAAGAGAGAGAAGAAGGGGG - Intergenic
1111054898 13:82936875-82936897 AAGGCAGAGGCAGAAGCTGGAGG - Intergenic
1111097606 13:83535379-83535401 AAGGCAGAGACAGAAGCTGCTGG + Intergenic
1113520638 13:110938062-110938084 AAAGAAGAAGAAGAAGATGGAGG + Intergenic
1113588317 13:111480781-111480803 AATGGGGAGCCAGAAGAAGGAGG - Intergenic
1113726345 13:112605510-112605532 AAAGTGGAGGCAGAAGACGGAGG - Intergenic
1113863545 13:113506734-113506756 AATGCAGAGCCAGAAGACACTGG - Intronic
1114532279 14:23403489-23403511 AGAGTAGAGCCAGAAAAAGGTGG + Intronic
1114707589 14:24743103-24743125 AAAGCAGAGGCAGCCTATGGTGG - Intergenic
1115970878 14:38943535-38943557 AGTGCAGAGCCAGGAGAAGGAGG - Intergenic
1117031991 14:51682270-51682292 AGAGAAGACCAAGAAGATGGGGG - Intronic
1117294638 14:54367680-54367702 AAAGGAGAGCCAGAAGATGGTGG + Intergenic
1117745825 14:58868528-58868550 GAAGAAGAGACAGAAGATGCTGG - Intergenic
1117792936 14:59360004-59360026 AAAAAAGAGCCAAAAGAGGGAGG - Intronic
1117898680 14:60511481-60511503 AAAGCAAAGCAAGAAGAACGTGG - Exonic
1118160934 14:63289474-63289496 AAAGCAGATTCAGAAGAGGTTGG - Intronic
1119123112 14:72098175-72098197 AAACCAGACCCCGAGGATGGGGG - Intronic
1119460541 14:74798805-74798827 AGACCAGAACCAGGAGATGGTGG + Exonic
1119927978 14:78515123-78515145 AAAGGAAAGCCAAAAGATGAAGG + Intronic
1120119729 14:80664468-80664490 AAAGCAGAGACAGAATATGAGGG + Intronic
1121077834 14:91084186-91084208 AAAAGAGAGACAGATGATGGTGG - Intronic
1121548514 14:94780582-94780604 AAAGCACACCCAAAAGGTGGAGG - Intergenic
1121720462 14:96105277-96105299 AAACCAGAGGAAGAAGATGCTGG - Intergenic
1121739743 14:96243083-96243105 AAACCTGAGCTAGAAGCTGGAGG + Exonic
1121822891 14:96985760-96985782 AAGACATAGCCAGAAGATGAAGG - Intergenic
1122683715 14:103487590-103487612 AAAGCAGGGGAAGAAGATGCAGG - Intronic
1122913676 14:104845941-104845963 ATAGCAATGCCAGAAGGTGGTGG + Intergenic
1202878748 14_KI270722v1_random:36537-36559 TAAACAGAGCCAGAATTTGGAGG - Intergenic
1123476270 15:20594181-20594203 ACAGAAGAGTCAGAAGATGCTGG - Intergenic
1123641742 15:22406183-22406205 ACAGAAGAGTCAGAAGATGCTGG + Intergenic
1123650469 15:22472536-22472558 AAATCAGAGCCCGTAGCTGGTGG - Intergenic
1123664928 15:22600557-22600579 ACAGCAGTGCTAGAAGAGGGTGG - Intergenic
1123727956 15:23123715-23123737 AAATCAGAGCCCGTAGCTGGTGG + Intergenic
1123740877 15:23281378-23281400 AAATCAGAGCCCGTAGCTGGTGG - Intergenic
1123746121 15:23321180-23321202 AAATCAGAGCCCGTAGCTGGTGG + Intergenic
1123752838 15:23372075-23372097 AGAGCAGTGCTAGAAGAGGGTGG + Intergenic
1123761640 15:23438093-23438115 AAATCAGAGCCCGTAGCTGGTGG + Intergenic
1124278389 15:28344497-28344519 AAATCAGAGCCCGTAGCTGGTGG + Intergenic
1124304312 15:28567111-28567133 AAATCAGAGCCCGTAGCTGGTGG - Intergenic
1124318758 15:28694974-28694996 AGAGCAGTGCTAGAAGAGGGTGG - Intergenic
1124492565 15:30167223-30167245 ACAGCAGAGCCAGGTGATAGGGG - Intergenic
1124564688 15:30802467-30802489 AGAGCAGTGCTAGAAGAGGGTGG + Intergenic
1124750969 15:32371102-32371124 ACAGCAGAGCCAGGTGATAGGGG + Intergenic
1125032726 15:35088751-35088773 AAAGCAGAGCCAGGTGATGAAGG + Intergenic
1125045276 15:35238025-35238047 AAAGGAGAACCTGAAGATGAGGG + Intronic
1125781522 15:42273452-42273474 AGAGCAGAGCCGGAAGAAGGCGG - Exonic
1126482249 15:49138223-49138245 AAGGCAAAGCCAGAAGCGGGGGG - Intronic
1126646164 15:50876835-50876857 AAAAAAAAGCCACAAGATGGAGG + Intergenic
1127045901 15:55025327-55025349 CAAGCAGAACCAGAAGGTGGAGG - Intergenic
1128094626 15:64944303-64944325 AAATCAGAGCCCAGAGATGGGGG - Intronic
1128225331 15:65997530-65997552 AAAATAAAGCCAGAGGATGGGGG - Intronic
1128238423 15:66082980-66083002 AAAGCAGAGGTATAGGATGGGGG - Intronic
1128536595 15:68495897-68495919 ACAGCAGTGCCAGAAGATCTAGG - Intergenic
1130540829 15:84819751-84819773 AAGGTAGACCCAGAAGATGTTGG - Intronic
1130856552 15:87844171-87844193 AAAACAGAGGCAGAAGAGGTGGG - Intergenic
1133906653 16:10028570-10028592 ATGGCAGAGCCACAAGATAGTGG + Intronic
1134429406 16:14187897-14187919 AAAGCAGAGGCTGAAAAAGGGGG - Intronic
1135198464 16:20415179-20415201 AAAATAGAGCCAGAACCTGGTGG + Intronic
1135504325 16:23022918-23022940 AAATCAGAGGCCGCAGATGGAGG - Intergenic
1135846499 16:25923581-25923603 AATGTAGAGCCAGAAGTTGCAGG - Intronic
1136086251 16:27887364-27887386 GAGGCAGAGCCAAGAGATGGAGG + Intronic
1136185685 16:28587559-28587581 AGGCCAGGGCCAGAAGATGGAGG - Intronic
1136516040 16:30768885-30768907 AAGGGAGAGCAAGAAGATCGCGG + Exonic
1136636029 16:31523900-31523922 AAAGGAGAGGCAGAAGAGGGAGG + Intergenic
1136666321 16:31816271-31816293 AAAGGAGAGGCAGAAGAGGGAGG + Intergenic
1137331335 16:47499968-47499990 GCAGCAGAGCCAAAAGATAGCGG - Intronic
1137685359 16:50382905-50382927 AAAGCAGAGCCAAGAGCTAGTGG + Intergenic
1137699687 16:50488642-50488664 AAAGCACAGAAAAAAGATGGAGG - Intergenic
1137726199 16:50658343-50658365 AAAGCAGGGTCAGGTGATGGTGG - Intergenic
1137806037 16:51306358-51306380 AAGGAAGAGACAAAAGATGGGGG - Intergenic
1138023585 16:53504945-53504967 AAAGCAGAGCCTGAAGACCAGGG - Intergenic
1138096702 16:54217567-54217589 AGAGAAGAGCCTGAAGGTGGAGG - Intergenic
1138150598 16:54653157-54653179 AAGGCAAAGCAAGCAGATGGTGG + Intergenic
1138589540 16:57992272-57992294 AGAGCAGAGCCAGTGCATGGTGG + Intergenic
1140143724 16:72285346-72285368 AAAGGGGAGCAAGAAAATGGGGG + Intergenic
1140908128 16:79427652-79427674 AAAGGAGAGGCAGAAAGTGGAGG - Intergenic
1141020497 16:80491489-80491511 AAAGCAGACCTAGGAGAAGGAGG - Intergenic
1141619168 16:85227738-85227760 AGCGCAGAGCCAGACTATGGTGG - Intergenic
1142028007 16:87824701-87824723 AAAGCAGAGGGAGGAGAAGGCGG - Intergenic
1143425214 17:6831010-6831032 AAAGAAGAGGAAGAAGAAGGAGG + Intronic
1143433617 17:6905702-6905724 TATGCAGAGCCACAAGATGAAGG - Intronic
1143657506 17:8304421-8304443 GAAGCAGAGCCAAGAGAGGGAGG - Intergenic
1143928281 17:10392836-10392858 GAAGCAGATCCAGAAACTGGAGG - Exonic
1143932564 17:10444981-10445003 GAAGCAGATCCAGAAACTGGAGG - Exonic
1143936832 17:10494936-10494958 GAAGCAGATCCAGAAACTGGAGG - Exonic
1143939327 17:10523501-10523523 GAAGCAGATCCAGAAACTGGAGG - Exonic
1144400771 17:14897887-14897909 AATGCAGAGCCAAGATATGGAGG + Intergenic
1145115533 17:20207086-20207108 AAATCAGACCCAGAACTTGGAGG - Intronic
1145238732 17:21227084-21227106 AAGGCGGAGTCAGAAGAAGGAGG + Intergenic
1145883569 17:28368291-28368313 AGAGCACAGCCAGCAGAGGGAGG - Intronic
1146305085 17:31724519-31724541 AGACCAGAGCCCCAAGATGGGGG - Intergenic
1146939876 17:36836978-36837000 AAAGCAGAGACAGCAGCTGATGG + Intergenic
1146985610 17:37214106-37214128 AAAGCAGAATCAGAAGAGGTCGG + Intronic
1147423252 17:40332776-40332798 ACAGCAGAAACAGAAGATGAAGG - Intronic
1147578814 17:41617404-41617426 ACAGCTGAGCCAGGGGATGGTGG - Intergenic
1149684656 17:58528422-58528444 AAACTAGAACCAGCAGATGGAGG + Intronic
1149734546 17:58980288-58980310 CAAGGAGGGCAAGAAGATGGTGG + Exonic
1149772949 17:59335391-59335413 AGAGATGAGGCAGAAGATGGGGG - Intronic
1150273632 17:63882303-63882325 AAAGCACAGCCAATAGATTGCGG + Intergenic
1150554859 17:66245285-66245307 CAAACAGAGCCAGTAGATGAAGG - Intronic
1150892046 17:69163266-69163288 AAAGCACAGCCACCAAATGGAGG + Intronic
1151726637 17:75888835-75888857 GGAGCAGGGCCACAAGATGGAGG + Intronic
1152380558 17:79940472-79940494 AAAGCAGAGACAGGAGAGGAAGG - Exonic
1153678196 18:7474588-7474610 AAAGCAGAGATAGCAAATGGAGG - Intergenic
1155228770 18:23753627-23753649 GAAGCAGAGGCAGCAGATGTGGG + Intronic
1155988605 18:32256449-32256471 AAAGGAGAGGCAGGAGAAGGTGG - Intronic
1156007287 18:32457540-32457562 AAAAAAGAAACAGAAGATGGGGG + Intronic
1156293716 18:35771950-35771972 AAAGAAAGGCCAGATGATGGAGG + Intergenic
1156507586 18:37608129-37608151 AAATCAGAGCCAGAGGACGGTGG + Intergenic
1156573937 18:38291221-38291243 AAAGCAGAGACCCAAGATGCAGG - Intergenic
1156958779 18:42997450-42997472 AAAGAAGAGAGAGAAGAAGGGGG + Intronic
1157080809 18:44523049-44523071 CAAGCAGAGTCAAAAGAGGGAGG - Intergenic
1157718876 18:49908076-49908098 TAAGCAGAGCCAGAGGCTGGGGG + Intronic
1158073425 18:53500224-53500246 GAGGCAGAGACAGAAGAAGGAGG + Intronic
1158601516 18:58859972-58859994 AAAGGAGAGCCAGAAGTACGGGG - Intergenic
1158960883 18:62586938-62586960 AAAGCAGAGCCCGAAAAGGAGGG - Intronic
1161005131 19:1931834-1931856 AAAGCAGTTCCAGAGGCTGGTGG + Intergenic
1161084624 19:2329040-2329062 GAAGCAGAACCGGAGGATGGAGG - Intronic
1161156779 19:2735903-2735925 AAAGCAGGGCCAGGGGTTGGGGG + Intronic
1161233972 19:3188975-3188997 AAAGCACACCGGGAAGATGGTGG - Intronic
1161859512 19:6787476-6787498 AAAGCAGAGTTAAGAGATGGAGG - Intronic
1162326034 19:10000162-10000184 ACAGCAAACCAAGAAGATGGTGG - Intronic
1163564840 19:18044990-18045012 GCAGCAGGGCCAGGAGATGGGGG - Intergenic
1163779436 19:19238818-19238840 AAAACAGGGCCAGGAGATGGAGG + Intronic
1164515562 19:28932463-28932485 AAAATAGAACCAGGAGATGGAGG - Intergenic
1164638102 19:29806164-29806186 AAAGCAGAGCCAGAGGTTCTGGG - Intergenic
1164862271 19:31571246-31571268 AAAGCAGAGGCAGATGTTGCAGG + Intergenic
1164972900 19:32547733-32547755 AGAGCAGAGCCAGGAGGTGGGGG - Intergenic
1165543929 19:36517474-36517496 AAAGAAAAGCCAGCAGATGTGGG + Intronic
1165733702 19:38162760-38162782 ACAGCAGAGCCACAAGAGGGAGG - Intronic
1165931640 19:39362925-39362947 CAAGCAGAGCCTGAAAGTGGAGG - Intronic
1166749343 19:45157366-45157388 AAAGCAGGGACAGGAGATGGGGG - Intronic
1166907600 19:46123999-46124021 AAAGCAGGGCCAGAAGGTGCAGG + Exonic
1166911393 19:46160746-46160768 AAAGCAGGGCCAGAAGGTGCAGG - Exonic
1167299554 19:48670991-48671013 ACAGCAGAGCCAGCACCTGGAGG + Exonic
1167570597 19:50286345-50286367 AAGGCAGAGACACAAGAGGGAGG - Intronic
1167766340 19:51485201-51485223 GAAGCAGAGCCAGAAGGGGAGGG + Intronic
1167859849 19:52273792-52273814 AGAGCAGAGCCAGAAGGTGGGGG + Intronic
1167880871 19:52456268-52456290 AGACCAGAGCCAGAAGATAGGGG + Intronic
1167970017 19:53183519-53183541 AAAGTACAGCCAGAAGGTGGGGG - Intronic
1202654371 1_KI270708v1_random:5571-5593 TAAACAGAGCCAGAATTTGGAGG - Intergenic
924981149 2:222714-222736 AGGGCAAAGCCAAAAGATGGTGG + Intronic
925515368 2:4675084-4675106 AAAGGAGACCCTGGAGATGGTGG - Intergenic
925881708 2:8358119-8358141 AAGGGAGAGACAGGAGATGGAGG + Intergenic
926447955 2:12967912-12967934 AAAGCAGAGACTGTAGCTGGAGG - Intergenic
926539971 2:14163867-14163889 AAAGCAGGGAGAGAAGGTGGGGG - Intergenic
927285097 2:21349082-21349104 AAAGCAGAGCCAGCAGAACCAGG + Intergenic
928337496 2:30410404-30410426 AAAGAAGAGCAGGAAGTTGGTGG - Intergenic
928905837 2:36366546-36366568 AAAGGAGAGGGAGTAGATGGTGG + Intronic
929107536 2:38378853-38378875 GAAGCAGAAGCAGAAGAAGGAGG + Intergenic
930025961 2:47029286-47029308 AGAGCAGTGCCAGCAGGTGGAGG - Exonic
930953798 2:57178337-57178359 AAGGAAGAGACAGAAGATAGAGG - Intergenic
931041618 2:58306852-58306874 AAAGAAAAGCCATAAGATGCTGG + Intergenic
932080021 2:68705572-68705594 AAAGCAGAGTGAAAAGATGGTGG - Intronic
932208175 2:69902392-69902414 GAAGCAGAACCAGAAGAAGCAGG - Intronic
932420495 2:71598589-71598611 GCACCAGAGCCAGAAGACGGTGG + Exonic
932514616 2:72333263-72333285 AAAGCACAGCCAAAATAAGGTGG - Intronic
932771084 2:74501208-74501230 AGAGCAGAGCCAGGCCATGGTGG + Intronic
933170657 2:79121399-79121421 AAACCAAAGACAGAAGATGTAGG + Intronic
934602647 2:95669659-95669681 AAACAAGAGCCAGAAGGGGGAGG + Intergenic
936573231 2:113633600-113633622 AAAGCAGAGCCAAATGACGCAGG - Intronic
937602300 2:123753310-123753332 GAAGGAGAGCAAGAAGATGAAGG + Intergenic
939098060 2:137858769-137858791 AAAGAAGACTCAGAAGATTGAGG - Intergenic
939998522 2:148943237-148943259 AAAGCAGAGCCAGGAGCTTTAGG + Intronic
941438257 2:165499183-165499205 AAACCAAAGCTAGAAGATGATGG - Intronic
942702210 2:178725436-178725458 AAAGCAGAGCCAGCTAATGCTGG - Exonic
942755987 2:179342113-179342135 GAAGCAGAGCCTGTAGTTGGTGG + Intergenic
944145123 2:196499103-196499125 CAAGCTGAGCAAGGAGATGGGGG - Intronic
944495191 2:200300267-200300289 AAAGAAGAGGCAGAAGAGGCAGG + Intergenic
945724461 2:213458733-213458755 TAAGGAGAGCCAGAAGATGATGG - Intronic
945753563 2:213818467-213818489 AAGGCAGAGCCAGATGTTTGAGG - Intronic
945765130 2:213966781-213966803 AAAGTAGAGTCAGAAGACTGTGG - Intronic
946005850 2:216524305-216524327 AACGAAGGGTCAGAAGATGGAGG + Intronic
946320369 2:218950585-218950607 AAAGCAGAGTCAACAGATGGGGG - Intergenic
946426736 2:219602506-219602528 AAAGCAGAGCCAGCCAAGGGAGG - Exonic
946629167 2:221647484-221647506 AAAGCAGAGCCACTAGAATGAGG + Intergenic
947370216 2:229438132-229438154 GAAGCAAAGACAGAAGAAGGGGG + Intronic
947946148 2:234104129-234104151 AAACCAGAGCCCAAAGATAGGGG + Intergenic
948518615 2:238521993-238522015 GAAGCAGAGCCTGGAAATGGAGG - Intergenic
1168953510 20:1818469-1818491 AAAGGAGAGACAGAATATTGTGG - Intergenic
1169041238 20:2497308-2497330 AAGGCAGAGGAGGAAGATGGAGG + Intronic
1169342401 20:4806203-4806225 CCAGCAGAGCCAGGAGCTGGTGG + Intronic
1170345746 20:15384918-15384940 GAAGCAGAGCCAGATTAAGGAGG - Intronic
1172328210 20:34054026-34054048 AAGGCAGAGTGAGAAGCTGGGGG - Intronic
1173001157 20:39106691-39106713 ATGGCAGAGCTAAAAGATGGCGG - Intergenic
1173327975 20:42050875-42050897 AAAGCAGGGCCAGGAGCTGTGGG + Intergenic
1173809035 20:45945189-45945211 AAGGGAGAGCCAGATGGTGGTGG + Intronic
1174194079 20:48760627-48760649 AAGGCTGAGCCAGGAGAGGGAGG + Intronic
1174483908 20:50849489-50849511 AAAGCAGAGCCAGGACAGGCAGG + Intronic
1175068526 20:56311814-56311836 AGGGCAGAGCCAAGAGATGGGGG - Intergenic
1176117845 20:63440772-63440794 AAAGCAGCGCCAGCACCTGGGGG + Intronic
1176177784 20:63736848-63736870 GCAGCAGAGACAGAAGCTGGGGG - Intronic
1176640059 21:9293977-9293999 TAAACAGAGCCAGAATTTGGAGG - Intergenic
1178810942 21:35880816-35880838 AAAGCAGAGACAGAGTCTGGTGG - Intronic
1180349073 22:11783359-11783381 TAAACAGAGCCAGAATTTGGAGG - Intergenic
1180373361 22:12066813-12066835 TAAACAGAGCCAGAATTTGGAGG - Intergenic
1180424105 22:12901440-12901462 TAAACAGAGCCAGAATTTGGAGG - Intergenic
1182001739 22:26925586-26925608 AACACAGAGCCAGAACTTGGAGG - Intergenic
1182297222 22:29316621-29316643 AGAGCAGAGGCGGAGGATGGGGG - Intronic
1182356465 22:29724373-29724395 ATAGCAGAGCCAGAAGAAGAGGG - Intronic
1182964988 22:34512563-34512585 AAAGCAAACCCAAGAGATGGGGG + Intergenic
1183772130 22:39935926-39935948 AAAACAGAGCAAGAAGATGGAGG + Intronic
1184987330 22:48144736-48144758 ACAGCTGACCCAGAAGATGCGGG - Intergenic
1185039099 22:48495372-48495394 AAAGCAAAGGCCGAAGATGATGG + Intronic
1185329151 22:50244339-50244361 AAAGCGGAGCCTCAAGAAGGTGG - Exonic
1185418829 22:50723882-50723904 GAAGCAGAGAGGGAAGATGGGGG - Intergenic
1185426954 22:50777280-50777302 AAAGCAGAGCCAAATGACGCAGG + Intronic
949262525 3:2119071-2119093 AAAGCAGATCCATAATGTGGTGG + Intronic
949828343 3:8186261-8186283 AAGGCAGAGACAGAAGCTGCTGG - Intergenic
949828817 3:8191820-8191842 AAAGAAGAGGAAGAAGAAGGAGG - Intergenic
950198424 3:11026060-11026082 AGGGCAGAGCCAGAAGATCAGGG - Intronic
951237098 3:20249470-20249492 AGAGCAGAGCAAGAGGTTGGGGG + Intergenic
951926652 3:27915254-27915276 AAAGAAGAGACAAGAGATGGGGG - Intergenic
952037835 3:29224637-29224659 ACATCAGTGCCAGAAGATAGAGG - Intergenic
953158717 3:40398434-40398456 AAAGCAGACCAAGAATATAGAGG + Intronic
953249501 3:41231438-41231460 TAAGCAGAGCCATAACATGCAGG + Intronic
953528533 3:43716119-43716141 AAAACAGAGCCTGAAGATAGTGG + Intronic
953682785 3:45052105-45052127 AAAGAAGAGCCTGGAGAAGGAGG - Intergenic
953753745 3:45629641-45629663 AAGGCAGAGACAGAAGCTGCTGG + Intronic
954004692 3:47581412-47581434 AAAGAAGAGATAGAAGATGTAGG + Intergenic
954157315 3:48693585-48693607 AAAGCAGAGCCTGAATACAGGGG + Intronic
954245120 3:49325337-49325359 AAATCGCAGCCAGAAAATGGTGG - Intronic
954551116 3:51482443-51482465 AAAACAGAGCCAGAAGAGCCAGG + Intronic
954750331 3:52810028-52810050 ACAGCAGAGGCAGAGGATGTGGG - Intergenic
955016390 3:55074164-55074186 AAAGCAGAGGGAGCAGAAGGAGG - Exonic
955654858 3:61234112-61234134 AATACAGAGCCAGAAGCTAGTGG - Intronic
956471642 3:69573347-69573369 AAAGCAGAGCTAGAGGCTGCAGG + Intergenic
956652552 3:71518624-71518646 AAAACACATGCAGAAGATGGTGG + Intronic
957100132 3:75816796-75816818 TAAACAGAGCCAGAATTTGGAGG + Intergenic
958705873 3:97654775-97654797 AAAGAAGAGCCAGATGCTGTAGG + Intronic
959768773 3:110068045-110068067 ATAGAAGAGCCAGAGGATGTTGG + Intergenic
960877370 3:122310612-122310634 AGAGCAGAGCCTGAAGAGAGAGG - Intergenic
961570922 3:127798356-127798378 AAAGCAGAGGCTGAAGCTGAAGG - Intronic
962050312 3:131806728-131806750 AAACCAGAGCAAGAAAATGAGGG - Intronic
962415839 3:135181167-135181189 AAACCAGAGCAGGAAGATGGCGG - Intronic
962559025 3:136586934-136586956 TAAGAAGAGCCAGAAAATGGAGG + Intronic
963065027 3:141256841-141256863 AGAGGAGAGCCAGAAGTGGGAGG + Intronic
963138275 3:141927722-141927744 CAAGCAGAGCCAGGAGAAGTTGG - Intergenic
963247020 3:143072983-143073005 GAAGCAGAGCCAAAAAATGGGGG + Intergenic
963559913 3:146851354-146851376 AAAGAAGAGGAAGAAGAAGGAGG + Intergenic
963631849 3:147742761-147742783 AAAGCTGCTCCAGAAGTTGGTGG - Intergenic
963708849 3:148722739-148722761 AAAACAGAGACGGAAAATGGTGG - Intronic
963994952 3:151697725-151697747 CAAGGATCGCCAGAAGATGGAGG - Intergenic
964194210 3:154043847-154043869 ATAACAGATCCAGAAAATGGTGG - Intergenic
964644802 3:158947523-158947545 AAAGGAGGGCAAGGAGATGGGGG + Intergenic
964904236 3:161698717-161698739 AAAGTAGAAACTGAAGATGGTGG - Intergenic
966002746 3:174970599-174970621 AAAGAAGAGACAGAAGCTGTGGG + Intronic
966068439 3:175844833-175844855 AAAGCAAAGTCAGAAAATGAAGG + Intergenic
966217647 3:177519666-177519688 AAGGCAGAGACAGAAGCTGCTGG + Intergenic
966825316 3:183960240-183960262 AGGGCAGGGCCAGAATATGGAGG - Intronic
966893584 3:184426091-184426113 TAAACAGACCCAGAAGCTGGGGG + Intronic
967214568 3:187199441-187199463 TAAGCAGAGCCTGGAGGTGGAGG - Intronic
967866151 3:194191673-194191695 TAAGCAGAGCTATAGGATGGGGG + Intergenic
968047237 3:195631261-195631283 ACAGCACAGCCAGGACATGGGGG - Intergenic
968292862 3:197552471-197552493 AATGGAGACCCAGAACATGGAGG - Intronic
968307375 3:197658663-197658685 ACAGCACAGCCAGGACATGGGGG + Intergenic
1202746836 3_GL000221v1_random:111045-111067 TAAACAGAGCCAGAATTTGGAGG + Intergenic
969412144 4:7035235-7035257 AGAGCAGGGCAAGAAGCTGGAGG - Intergenic
970155677 4:13139623-13139645 AGTGGAGAGACAGAAGATGGTGG + Intergenic
970157029 4:13151882-13151904 AAAGCAGACCAAGATGATGCAGG - Intergenic
971497589 4:27283659-27283681 ATGGCAGAGCCACAAGATGGAGG + Intergenic
971651668 4:29283706-29283728 AAATCCAAGCCAGAAGATAGTGG - Intergenic
971704677 4:30025178-30025200 AAAGGGGAGCCAGAAGAGGAAGG + Intergenic
972538651 4:40020391-40020413 AATGCCGAGCCGGAAGCTGGTGG - Intergenic
972805008 4:42520537-42520559 AATGGAGAGCGAGAAGGTGGAGG + Intronic
975564280 4:75737673-75737695 ACAGCAGAGCAAGAAGATCCTGG + Intronic
976684264 4:87794139-87794161 TAGGCAAAGCCAGATGATGGAGG - Intergenic
978385064 4:108169875-108169897 AGAGCAAAGCCAGAAGAGGGAGG + Intergenic
979703869 4:123697306-123697328 AAAGCAGAGGTTGAAGGTGGTGG + Intergenic
980728666 4:136799093-136799115 AAAGGAGAGAGAGAAAATGGAGG + Intergenic
981049168 4:140293860-140293882 AAAGCAGAGCCAGTGACTGGGGG + Intronic
982538314 4:156635270-156635292 AAACCAGACTCACAAGATGGGGG - Intronic
984846200 4:184110058-184110080 GAAGCAGAGCCAGGGGAAGGAGG + Intronic
985334486 4:188877167-188877189 ACAGCAGAGACATAAGAAGGAGG - Intergenic
1202754950 4_GL000008v2_random:52381-52403 TAAACAGAGCCAGAATTTGGAGG - Intergenic
985618453 5:938524-938546 AAGGCAGGGACAGAGGATGGAGG + Intergenic
986021901 5:3812387-3812409 GAAGCAGAGCCAGATGGTGTGGG + Intergenic
986551528 5:8961366-8961388 AAAGCAGAACCAAAAGGTGAAGG - Intergenic
986658386 5:10037509-10037531 AAAACAGAGGCAGAAATTGGAGG + Intergenic
987012378 5:13780875-13780897 AAAGCAGAGCCTGACGAGGTTGG - Exonic
987070508 5:14333110-14333132 AAAGCAGCACCAGAGGATGTTGG + Intronic
987071964 5:14346187-14346209 AAATCAGAACCAGAAGATCAAGG + Intronic
987665837 5:20937899-20937921 AAAGCAGGGACAACAGATGGGGG - Intergenic
988756854 5:34264267-34264289 AAAGCAGGGACAACAGATGGGGG + Intergenic
988815038 5:34826416-34826438 AAGGCAGAGTCAGCAGCTGGAGG + Exonic
990240231 5:53809811-53809833 AAAGCTGAGAGAGAAGATGCAGG - Intergenic
990560663 5:56980277-56980299 AAGGCAGAGACAGAAGCTGCTGG - Intergenic
990970841 5:61504168-61504190 AAAGCAGAAGAAGAAAATGGAGG - Intronic
992207198 5:74442492-74442514 AAAGTGCAGCCAGCAGATGGTGG - Intergenic
993496176 5:88611602-88611624 AAGCCCTAGCCAGAAGATGGAGG + Intergenic
993969890 5:94406301-94406323 AGAGCAGTTACAGAAGATGGAGG - Intronic
996014846 5:118521743-118521765 AAAGCAGAGAATGCAGATGGTGG - Intergenic
996149387 5:120017010-120017032 AAAGCAGAAGCAGAAGAAGCTGG + Intergenic
996476064 5:123922132-123922154 ACACCAGAGCCTGAAGATAGAGG - Intergenic
996507662 5:124286516-124286538 AAAGAAGGGCCAGATGATTGAGG + Intergenic
996591147 5:125149116-125149138 CAAGCAGAGCCACAGGATGGAGG - Intergenic
998501401 5:142636082-142636104 AAAACAGAGCAAGAAGGAGGGGG - Intronic
999132197 5:149292809-149292831 AGAGCAAAGACAGGAGATGGGGG + Intronic
999830398 5:155313481-155313503 AAAGTAAAGCCATGAGATGGTGG - Intergenic
1000175249 5:158745863-158745885 GAATCAGAGCCTGAAGGTGGAGG - Intronic
1000367653 5:160506072-160506094 AAACCAGAGGCGGAAGCTGGAGG - Intergenic
1000606444 5:163332477-163332499 TTAGCATAGCCTGAAGATGGAGG - Intergenic
1000806635 5:165802348-165802370 ACTGCAGAGGCAGAAAATGGGGG + Intergenic
1000811123 5:165863328-165863350 AAAGCAGAGCAAGGAGGTGTGGG - Intergenic
1001502193 5:172245846-172245868 AAAGGAGAGGCAGAACATGCCGG + Intronic
1001694298 5:173658713-173658735 AATGCAGAGCCACAAGATGGAGG - Intergenic
1001706089 5:173742013-173742035 AAAGCAGTGCAAGAAGCAGGTGG + Intergenic
1002450123 5:179314105-179314127 GATGCAGAGCCTGAAGCTGGAGG - Intronic
1002511638 5:179723482-179723504 TAAGGAGAGCAAGAGGATGGAGG + Intronic
1002521286 5:179794418-179794440 GAAGCAGAGCCAGGGAATGGGGG - Intronic
1002669641 5:180856165-180856187 TAAGCAGAGCCAGAACAGGGAGG - Intronic
1003001401 6:2338033-2338055 AAAGAAGAGGAAGAAGAAGGAGG + Intergenic
1003876042 6:10438012-10438034 ATGGCAGAGCAACAAGATGGAGG - Intergenic
1004943549 6:20586891-20586913 AAAGAAGAGCAAGAAAATGAGGG - Intronic
1005220966 6:23588074-23588096 GAAGCTAAGCCAGAAGCTGGTGG - Intergenic
1006231099 6:32587494-32587516 AATGGAGAGGCAGAAGATGAGGG - Intronic
1006503771 6:34475074-34475096 AAAGTAGAATCAGGAGATGGGGG - Intronic
1006765131 6:36498325-36498347 AAAGCTGAGAAAGAAGGTGGAGG + Intronic
1006945174 6:37779843-37779865 AGAGCAGGGACAGGAGATGGGGG - Intergenic
1007370115 6:41421259-41421281 AAAGCAGAGCCTGAGGCAGGTGG + Intergenic
1007597877 6:43062796-43062818 ACAGAGGAGCCAGAAGGTGGGGG - Intronic
1007659972 6:43477882-43477904 GAAGCAGAGTCACAAGTTGGAGG + Intronic
1009271541 6:61621161-61621183 AAATCCGTGGCAGAAGATGGAGG + Intergenic
1010064561 6:71666927-71666949 GAAGCAAAGCCAGATCATGGTGG - Intergenic
1010500022 6:76586680-76586702 AAAGCAGAGAATGGAGATGGGGG - Intergenic
1010561469 6:77356904-77356926 AAAGCAGAGTCAGAAAATCAGGG + Intergenic
1010958085 6:82114365-82114387 CAAGTAAAGCCAGAAAATGGTGG - Intergenic
1011798447 6:90982980-90983002 AAAGAAGAGAGAGAAGAAGGTGG - Intergenic
1012896129 6:104951885-104951907 AAAGCCCAGCTAGAAAATGGAGG - Intergenic
1013002178 6:106034281-106034303 AACCCAAAGCCAGAAGATGAAGG - Intergenic
1013569918 6:111411971-111411993 AAATGGGAGCCAGAAGAAGGCGG - Intronic
1014233536 6:118930472-118930494 AAAGCAGGTCCAGAATATTGAGG - Intronic
1014443988 6:121505345-121505367 AAAGGAGAGGGAGAAGAAGGTGG - Intergenic
1014489414 6:122043790-122043812 GAAGCAAGGACAGAAGATGGGGG + Intergenic
1014562022 6:122902371-122902393 ATCTCTGAGCCAGAAGATGGAGG - Intergenic
1017100805 6:150848284-150848306 AAGGCAGAGACAGATTATGGGGG - Intergenic
1017179765 6:151540354-151540376 AAAGCAGCAGCAGAAGAAGGAGG - Intronic
1017751808 6:157495632-157495654 AAGGCAGAGCAGGAGGATGGTGG + Intronic
1018737381 6:166697591-166697613 ATGGTAGAGCGAGAAGATGGAGG + Intronic
1018788268 6:167125684-167125706 AAAGCAGAACCAGAAGAAAGAGG - Intronic
1018891833 6:167988303-167988325 TAAGCAGAGCCAGAGGCAGGAGG + Intergenic
1020120403 7:5500158-5500180 TCAGCAGAGCCAGTAGGTGGGGG - Intronic
1020411293 7:7894736-7894758 AGAGCAGATACAGAAGATGTAGG - Intronic
1020965896 7:14868115-14868137 ACATCAGAGCCAGAAGAAGAAGG - Intronic
1021000596 7:15325904-15325926 AAAGAAGAGGAAGAAGACGGAGG + Intronic
1021068908 7:16212692-16212714 AAAGCGGAGACAGAGGATGGTGG - Intronic
1021984392 7:26084930-26084952 AAAGGAAAGCCAGTAGCTGGGGG + Intergenic
1023215178 7:37854682-37854704 AAAGCAGTGCCAGACGATGAGGG - Intronic
1023752312 7:43384406-43384428 AAGACAGAGCCCCAAGATGGCGG + Intronic
1023870389 7:44260260-44260282 GAACCAGAGCCAGAGGAGGGAGG - Intronic
1026304120 7:69125144-69125166 CAAGCAAAGAAAGAAGATGGTGG + Intergenic
1026963251 7:74423268-74423290 AAAGCAGAGCCAGAGAATTTGGG + Intergenic
1027381575 7:77615817-77615839 AAAAGAGAGTCAGAAGATGTGGG + Intronic
1027459370 7:78434029-78434051 AAAGCAAAGAGAGAATATGGAGG - Intronic
1027765017 7:82328576-82328598 AAAGCAGACAGAGAAGATCGAGG - Intronic
1030290811 7:107870994-107871016 AACACAGAGACAGAAGATGCGGG + Intergenic
1031187851 7:118505719-118505741 AAAGAACAGCAAGAAGATTGAGG + Intergenic
1032544959 7:132734168-132734190 AAGGCAGAGACAGAAGCTGTTGG + Intergenic
1032742139 7:134749606-134749628 AAAGCAAGGCCAGAAGAGTGAGG + Intronic
1033133737 7:138767777-138767799 TAGGCAGAGCCAGATCATGGAGG - Intronic
1033322048 7:140348705-140348727 AAAGGGGAGCCAGAAGAAGAAGG + Exonic
1034248613 7:149670058-149670080 AAAGAAGAAGCAGAAGAAGGAGG - Intergenic
1035122530 7:156580098-156580120 CAAGGACAGCCAGAGGATGGGGG + Intergenic
1035604378 8:920058-920080 TCAGCAGAGCGAGAAGGTGGAGG + Intergenic
1035719732 8:1783002-1783024 AGTGCAGAGCCTGAAGTTGGGGG + Exonic
1036123992 8:6046579-6046601 AGAGTAGGGCCAGAAGCTGGGGG + Intergenic
1036581548 8:10080132-10080154 AAGGCAGAGAAAGAAGATGGAGG + Intronic
1036598001 8:10231386-10231408 AAAACAGAGACAGAAGATATTGG + Intronic
1036712266 8:11087647-11087669 ACGGCAGAGCAAAAAGATGGAGG + Intronic
1037326770 8:17699672-17699694 ACAGCAGAGCAAGAAGCTGCAGG + Intronic
1037407607 8:18560369-18560391 AAAGCAAAGACAAAAGGTGGGGG - Intronic
1038494410 8:27991329-27991351 CAGGCAGAGTCAGAAGATGCTGG - Intronic
1038796633 8:30716272-30716294 AAACCAGAGGAAGAGGATGGTGG + Intronic
1039058248 8:33553720-33553742 ATGGAAGAGGCAGAAGATGGGGG + Intronic
1039356166 8:36818721-36818743 TACACAGTGCCAGAAGATGGAGG - Intronic
1039759038 8:40554271-40554293 AAAGCAGAAGCAGAAGTTGGTGG - Intronic
1040338745 8:46429328-46429350 AAAACAAAGCCACAAGGTGGTGG + Intergenic
1040577737 8:48668742-48668764 AAAGCTGAGCAAGATGTTGGGGG - Intergenic
1041095270 8:54343265-54343287 AAAGCAGAGGAAGACGAAGGAGG - Intergenic
1041311057 8:56516854-56516876 AAAGCAGAGACAGATTATGGAGG + Intergenic
1041557671 8:59176078-59176100 AAAGAAGAGAAAGATGATGGTGG + Intergenic
1041981601 8:63867825-63867847 AAAGAATAGCTAGAAGATGCTGG - Intergenic
1042497108 8:69467557-69467579 AAAGCAGAGAAGGAAGAAGGAGG + Intronic
1042503513 8:69535733-69535755 AAAGCAAAGCCATAAGAGGCCGG + Intronic
1042756326 8:72216414-72216436 AAAGGAGAAAAAGAAGATGGAGG + Intergenic
1043000013 8:74746695-74746717 AGAGAAGAGAGAGAAGATGGAGG + Intronic
1043254413 8:78115651-78115673 ATGACTGAGCCAGAAGATGGTGG + Intergenic
1043364015 8:79510481-79510503 AATGCAGATCCAAGAGATGGTGG + Intergenic
1044554020 8:93542503-93542525 AAACAAGAGGCAGAAGATGCTGG - Intergenic
1045107577 8:98907871-98907893 AAAAAAGAGCCAGAGGAAGGAGG - Intronic
1045204284 8:100021299-100021321 AAAGCTGAACCAGAAGAGGAGGG + Intronic
1045840883 8:106579318-106579340 ACAGGAGAGCCAGAAGTTTGAGG - Intronic
1046899748 8:119511298-119511320 AAATCTCAGTCAGAAGATGGAGG + Intergenic
1047313208 8:123709466-123709488 AAATCAGAGCTAGAGAATGGGGG - Intronic
1047324580 8:123824269-123824291 AAAGAAGAGGCAGAAGATGCTGG - Intergenic
1047714847 8:127586116-127586138 AAAGCAGAGCCAGTGGCAGGAGG - Intergenic
1048326506 8:133443208-133443230 CCAGCAGAAGCAGAAGATGGAGG - Intergenic
1048672671 8:136740555-136740577 GAAGCAAAACCAGAAGAGGGAGG + Intergenic
1049554277 8:143274435-143274457 TAAGCAGAGCCAAAACCTGGGGG - Intronic
1051188796 9:14488538-14488560 AAAGCAGTGCCAGCATAGGGTGG - Intergenic
1051318458 9:15870307-15870329 AAAGGAGGGCAAGAAAATGGAGG + Intronic
1051580289 9:18665660-18665682 AAAGTAAAGAAAGAAGATGGTGG - Intronic
1051864104 9:21659618-21659640 AAAGCAGAGCCAGAAGCTGAAGG + Intergenic
1052127580 9:24796848-24796870 AAAGAAGAGGGAGAAGATGTGGG + Intergenic
1052190324 9:25653972-25653994 AAAGCAGAGCCTGAAGCAAGGGG - Intergenic
1052864051 9:33454244-33454266 ACAGCAGAGCGATAGGATGGAGG + Intergenic
1054728897 9:68680447-68680469 AAACAAGAGACAGAAGATGAAGG - Intergenic
1055561560 9:77526574-77526596 AAGGCAGAGGCAGAGGCTGGAGG + Intronic
1055638910 9:78304220-78304242 AAAGCAGAGCCAGAAGATGGGGG - Intronic
1056016400 9:82392814-82392836 CAAGAAGAGCTGGAAGATGGGGG - Intergenic
1057209781 9:93193457-93193479 CAAGCCGAGCCAGCAGGTGGAGG + Intronic
1059541966 9:115139220-115139242 AAGGCAAAGCAAGAAGGTGGTGG - Intergenic
1059916645 9:119110653-119110675 AAAGAAGAACCAGGAGATTGTGG - Intergenic
1061441378 9:130606288-130606310 AAAGAAGAGGCAGAGGAGGGGGG + Intronic
1062161265 9:135081464-135081486 AAAGCAGGGCAAGAAGGAGGGGG + Intronic
1203715473 Un_KI270742v1:141138-141160 TAAACAGAGCCAGAATTTGGAGG + Intergenic
1203535746 Un_KI270743v1:37090-37112 TAAACAGAGCCAGAATTTGGAGG - Intergenic
1203649719 Un_KI270751v1:104716-104738 TAAACAGAGCCAGAATTTGGAGG + Intergenic
1185825526 X:3245545-3245567 ATGGCAGAGAGAGAAGATGGTGG + Intergenic
1186305833 X:8256562-8256584 AAAAAAAAGCCAGAAGCTGGTGG - Intergenic
1186664336 X:11703012-11703034 CAAGCAGAGGAAGAAGCTGGGGG - Intergenic
1187529068 X:20080290-20080312 AAAGGAGAGCATGAAGGTGGAGG - Intronic
1187607094 X:20896925-20896947 TAAGCAGGGACAGAAGATGAAGG - Intergenic
1187847873 X:23559563-23559585 ATAGCAGAGCAACAAGATGGAGG + Intergenic
1189146314 X:38658663-38658685 GAAACAGAAGCAGAAGATGGTGG - Intronic
1192338329 X:70240167-70240189 AAAGCCAAGCCAGGAGATGGTGG + Exonic
1193047056 X:77064620-77064642 AAAGCAGATTGAGTAGATGGGGG - Intergenic
1193149377 X:78108669-78108691 AAGGCAGAGGAAAAAGATGGAGG + Intronic
1193542025 X:82783600-82783622 AAAGAAGAGCCAGATGGTTGAGG - Intergenic
1193677715 X:84477134-84477156 GGAGAAGAGCCAGAAGATGGAGG + Intronic
1193814090 X:86084738-86084760 AAAGAAGATCCAGAAGCTGATGG - Intergenic
1194343890 X:92738631-92738653 GAAGCAGAGCCAAAAGAATGAGG - Intergenic
1194505339 X:94727248-94727270 AAAGCAGAGCCAATAGTTGTTGG + Intergenic
1195057778 X:101163185-101163207 AACGCAGAGCCTGATGATGAAGG - Exonic
1195907266 X:109856764-109856786 AAGGCAGAGAGAGAGGATGGGGG + Intergenic
1196465624 X:115969092-115969114 ACAGGAGACACAGAAGATGGAGG - Intergenic
1197045808 X:121996873-121996895 ATAGCTGAGCCAGAATATGTGGG + Intergenic
1198795008 X:140385274-140385296 AAAGCAAAAGCAGAAGAGGGAGG - Intergenic
1200041437 X:153373196-153373218 AGAGCAGAGCCAAAAGAAAGAGG + Intergenic
1200133110 X:153862197-153862219 AAAGAAAAGACAGCAGATGGTGG + Exonic
1200652242 Y:5855287-5855309 GAAGCAGAGCCAAAAGAATGAGG - Intergenic
1201169703 Y:11246086-11246108 TAAACAGAGCCAGAATTTGGAGG + Intergenic