ID: 1055638911

View in Genome Browser
Species Human (GRCh38)
Location 9:78304221-78304243
Sequence GAAAGCAGAGCCAGAAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 12, 3: 60, 4: 631}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055638911_1055638915 -2 Left 1055638911 9:78304221-78304243 CCCCATCTTCTGGCTCTGCTTTC 0: 1
1: 0
2: 12
3: 60
4: 631
Right 1055638915 9:78304242-78304264 TCTTATGTGTTCTCTTCATTGGG No data
1055638911_1055638916 1 Left 1055638911 9:78304221-78304243 CCCCATCTTCTGGCTCTGCTTTC 0: 1
1: 0
2: 12
3: 60
4: 631
Right 1055638916 9:78304245-78304267 TATGTGTTCTCTTCATTGGGTGG No data
1055638911_1055638914 -3 Left 1055638911 9:78304221-78304243 CCCCATCTTCTGGCTCTGCTTTC 0: 1
1: 0
2: 12
3: 60
4: 631
Right 1055638914 9:78304241-78304263 TTCTTATGTGTTCTCTTCATTGG No data
1055638911_1055638917 11 Left 1055638911 9:78304221-78304243 CCCCATCTTCTGGCTCTGCTTTC 0: 1
1: 0
2: 12
3: 60
4: 631
Right 1055638917 9:78304255-78304277 CTTCATTGGGTGGCCACCATTGG No data
1055638911_1055638918 18 Left 1055638911 9:78304221-78304243 CCCCATCTTCTGGCTCTGCTTTC 0: 1
1: 0
2: 12
3: 60
4: 631
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638911 Original CRISPR GAAAGCAGAGCCAGAAGATG GGG (reversed) Intronic
900198989 1:1394190-1394212 GAAAGCCGAACAAGCAGATGAGG + Intronic
900535587 1:3175583-3175605 AAAAGAGGAGCCAGAGGATGGGG + Intronic
900894989 1:5477128-5477150 GAAAGCAGAGCCTGAAGCAAGGG - Intergenic
900938166 1:5780212-5780234 GAAAGCAGAGCCAGAGTTGGGGG + Intergenic
901269638 1:7941994-7942016 GAAAGAAGAGGGAGAAGAGGAGG + Intronic
901289348 1:8110867-8110889 AGAAGCGGAGCCTGAAGATGTGG + Intergenic
901586080 1:10294093-10294115 GAAAGAAGAGTCAGATGAGGGGG - Intronic
903107524 1:21095670-21095692 AAAATCAGAGCCAGAACAAGGGG - Intronic
903421096 1:23218069-23218091 GAAAGCAGAGAAAGAAGGTAGGG + Intergenic
903913774 1:26748257-26748279 GAGAGGAGAGCCAGATGATGTGG + Intronic
903933686 1:26879773-26879795 GATAGCATAGGCAGAGGATGGGG + Intronic
905013875 1:34764036-34764058 GGAAGCAGAGCCAGAGGCAGGGG + Intronic
905647678 1:39635715-39635737 TGAAGCGGAGCCAGAAGATGCGG - Intronic
906066501 1:42984822-42984844 GGCAGCAGAGCCTGGAGATGGGG + Intergenic
906661478 1:47585914-47585936 GAAATTACAGCCAGAAGAGGAGG + Intergenic
906944664 1:50285485-50285507 GACAGCTGAGCCAGATGAAGTGG - Intergenic
907077260 1:51590225-51590247 GAAAGCAGAAACAGAAGCAGAGG + Intronic
907199163 1:52711390-52711412 TAGAGCAGAGCCAGAAGACATGG + Intergenic
907199175 1:52711571-52711593 TAGAGCAGAGCCAGAAGACATGG + Intergenic
907530088 1:55086378-55086400 GCAAACAGATCCAGAATATGGGG + Intronic
907564224 1:55419664-55419686 GAAAGCAGAGCCTGAGGCAGAGG - Intergenic
908284146 1:62575288-62575310 GGTAGCAGAGGCAGAAGAGGTGG - Intronic
908800548 1:67875644-67875666 TAAAGCAGGGCCAGAAGATGCGG + Intergenic
909078705 1:71083555-71083577 GAAAGAAAAACCAGAAGAGGGGG + Intergenic
909862143 1:80621025-80621047 GAAAGCACTGACTGAAGATGAGG - Intergenic
909943466 1:81636614-81636636 GAAAACTGGGCCAGAAAATGGGG - Intronic
909994497 1:82262363-82262385 GAAAGATGAGGCAGAAGGTGGGG - Intergenic
910394239 1:86775848-86775870 GAAATAGGAGCCAGAAGATCAGG + Intergenic
911150391 1:94592516-94592538 GAAAGAAGAGCTATGAGATGTGG - Intergenic
911222450 1:95263273-95263295 GACAGTAGAGCCTGAAGATAAGG - Intergenic
911715438 1:101127415-101127437 GTAAACAGGGCCAGAAAATGGGG + Intergenic
911747587 1:101456460-101456482 GAAAGGAGAGAGAGAAAATGTGG + Intergenic
911870698 1:103094253-103094275 CAAACCAGTGTCAGAAGATGGGG + Intronic
911870721 1:103094545-103094567 GATGGCAGAGGCAGAAGAAGTGG - Intronic
912014484 1:105016135-105016157 GACAGGAGAGCAAGAAGATCTGG + Intergenic
912042360 1:105408413-105408435 GAAAACAGAGGTAGAGGATGGGG + Intergenic
912417844 1:109522258-109522280 GAAAGGAAAACCTGAAGATGTGG - Intergenic
912645956 1:111391822-111391844 GATGGCAGAGCCAGAGGTTGGGG + Intergenic
912747125 1:112254121-112254143 GTGAGCAGAACCAGATGATGAGG - Intergenic
912841185 1:113040985-113041007 CAAACCAGAGCCAGATGAAGAGG + Intergenic
913058201 1:115181299-115181321 GAGAGGAGGGCCAGAGGATGGGG - Intergenic
913229741 1:116731813-116731835 GAAAGCAGAGACAAGAGATATGG + Intergenic
913423470 1:118699585-118699607 CCAAACAGTGCCAGAAGATGAGG + Intergenic
914718896 1:150273024-150273046 GAAGGCAGAGCCAGGAAAGGGGG + Intronic
914964031 1:152237105-152237127 GGTAGCAGAGGCAGAAGAAGAGG - Intergenic
915083690 1:153369788-153369810 GAGGGGAGAGCCTGAAGATGGGG - Intergenic
915267715 1:154730958-154730980 CAGAGTAGAGCCAGGAGATGCGG + Intronic
915318115 1:155041167-155041189 GTACGCAGAGCCAGGACATGTGG + Intronic
915418817 1:155763456-155763478 GAACTCTGAGCCAGAAGAAGAGG - Exonic
915500692 1:156314780-156314802 CAAAGCAGTGCCAGACGATGAGG + Intronic
916085413 1:161265526-161265548 GAAAAAAAAGCAAGAAGATGGGG + Intronic
916307952 1:163360786-163360808 GGAGGCAGAGGCAGAAGAGGTGG + Intergenic
916438980 1:164803616-164803638 GAACGCAGAGGCATATGATGTGG + Intronic
916781980 1:168043282-168043304 GATAGCAAATCCAAAAGATGGGG + Intronic
916827117 1:168453080-168453102 GAAAGCAGAGCAAGCGGATGGGG - Intergenic
918100523 1:181369313-181369335 AGAAACAGAGCCCGAAGATGCGG - Intergenic
918138627 1:181700916-181700938 GAAAGAAGAGCCAAAATATGAGG - Intronic
918265768 1:182839992-182840014 AAAAGCAGAGCCTGCAGAAGCGG + Intronic
918442708 1:184584010-184584032 TAAAGCAGACCCAGCAGAGGGGG - Intronic
918578492 1:186095430-186095452 CAAAGCAGAGACTGAAGATTCGG + Exonic
918601322 1:186365924-186365946 CAAACCAGTGCCAGACGATGTGG + Intronic
919269181 1:195316777-195316799 GAGCACAGAGCCGGAAGATGGGG - Intergenic
919742763 1:200990702-200990724 GAAAGAAGTTCCAGAAGAAGGGG - Exonic
920721432 1:208390619-208390641 GAAGGCAGAAGCAGAAGCTGGGG - Intergenic
920774074 1:208918750-208918772 GAAAGCAGAACCCAAAGAGGTGG + Intergenic
921026797 1:211291721-211291743 GAAAGCAGAGGAAGCAAATGTGG - Intronic
921178095 1:212610275-212610297 AAAAGGAGAGCCAGAAAATCTGG + Intronic
921741184 1:218686992-218687014 GAAAGAACAGCCAGAATGTGAGG - Intergenic
922787245 1:228289105-228289127 GTAGGCAGAGACAGAGGATGTGG + Intronic
922891432 1:229064875-229064897 GGGAACAGAGCCAGATGATGGGG + Intergenic
923118424 1:230966691-230966713 GACAGCACAGTCAGAAGATATGG + Intronic
923268522 1:232334754-232334776 AGAAGGAGAGCCAGAAGATGAGG - Intergenic
923405029 1:233651383-233651405 GAAAGCAAACCCAGAGGAGGTGG + Intronic
923559176 1:235025470-235025492 GAAAACAGCTCCAGAAGCTGAGG + Intergenic
924612916 1:245588725-245588747 GGAAGGAGACCCAGAGGATGGGG - Intronic
1062808332 10:441959-441981 TAAAGCAGAGACAGACGCTGTGG + Intronic
1063109309 10:3020772-3020794 GAAAGAAGACCAGGAAGATGCGG - Intergenic
1063904871 10:10771144-10771166 GAATGCAAAATCAGAAGATGGGG - Intergenic
1064302193 10:14132590-14132612 GAGAGCAGAGACAGTAGATCTGG + Intronic
1064455203 10:15481142-15481164 GTCAGCAGAGCCAGGAGAGGAGG - Intergenic
1065261585 10:23929054-23929076 GAAAGAAGAGGTACAAGATGAGG + Intronic
1065763073 10:29001340-29001362 GAAGGCAGAGCTAGAAGCAGTGG + Intergenic
1066187707 10:33026498-33026520 GAAATCAGAGCCAGGAGAGAGGG - Intergenic
1066254687 10:33667059-33667081 GAAAGCAGAACCAGAGGATGGGG + Intergenic
1067023152 10:42819632-42819654 GAAAGGAAAGAAAGAAGATGTGG + Intronic
1067094508 10:43290310-43290332 GAAAACACAGACAGATGATGTGG + Intergenic
1067548288 10:47212892-47212914 AGAAGCAGAGCCTGAATATGTGG + Intergenic
1067749913 10:48964165-48964187 GAAAGCACAGGAAGATGATGGGG - Intronic
1068336033 10:55633221-55633243 GAAAAGAGAGGCAGAAGAGGAGG + Intergenic
1068765390 10:60757665-60757687 AAGAGCAGAGACAGCAGATGCGG + Intergenic
1069049957 10:63781899-63781921 GAAAAGAGAACCAGAAGATGGGG - Intergenic
1070238564 10:74655597-74655619 GAAAGAGGAGCTACAAGATGAGG + Intronic
1070653564 10:78255136-78255158 GAAAACAGGTCCAGAGGATGGGG + Intergenic
1071006809 10:80892673-80892695 AAAATCAGGGCCAGAAGCTGTGG - Intergenic
1071840148 10:89461971-89461993 ATAAGCAGCTCCAGAAGATGTGG - Intronic
1073052216 10:100674707-100674729 GGAACCAGAGTGAGAAGATGGGG - Intergenic
1073220504 10:101868521-101868543 GATGGCAGAGGCAGAAGAGGTGG - Intronic
1073852293 10:107634929-107634951 GTCAGCAGAGCCAGATGATAAGG - Intergenic
1073909802 10:108328634-108328656 GCAAAGAGAGCCAGAAGATTAGG - Intergenic
1074564535 10:114565356-114565378 AAAAGCAGAGTCACAAAATGTGG + Intronic
1074690357 10:115998767-115998789 GAAGTCAGAGCCAGAAGACATGG + Intergenic
1074995661 10:118755100-118755122 GAAAGCGGAGCCAAAAGGGGCGG + Exonic
1075210258 10:120484916-120484938 AAAAGAAGAGGCAGAAGAGGAGG + Intronic
1075561830 10:123473839-123473861 GAAAGGAGGGCCAGAAGGGGTGG - Intergenic
1075730273 10:124631650-124631672 GGAAGCAGAGCCTGAGGAAGAGG - Intronic
1075978034 10:126713803-126713825 GAAAGCTGAGTCAGAAGACCTGG + Intergenic
1076207315 10:128613433-128613455 GAAAGCAGAACCAAGGGATGGGG + Intergenic
1076728976 10:132429014-132429036 GGAAGCAGAGCCAGAAGGCTGGG + Intergenic
1077482159 11:2820848-2820870 GAAGGAAGAGCCAGGGGATGTGG - Intronic
1077986487 11:7356441-7356463 GAAAACAGAACCAGCAGAAGGGG - Intronic
1078082956 11:8217382-8217404 GAAAGCAGAGGGACAGGATGAGG + Intergenic
1078386213 11:10895165-10895187 GAAAAGAGGGCCAAAAGATGGGG + Intergenic
1078405103 11:11063751-11063773 GAAAGCAAAGCAAAAAGATAAGG - Intergenic
1078465634 11:11548002-11548024 GAATTCAGAGTCAGAAGATAGGG - Intronic
1079897653 11:26142106-26142128 GAAGTCATAGCCAGAAGATGAGG + Intergenic
1080106366 11:28515211-28515233 TAAAGCAGAGCCACATGATTTGG - Intergenic
1081617571 11:44599844-44599866 GAGAAAAGAGCCAGGAGATGTGG + Intronic
1081648318 11:44805452-44805474 GAAACTGGAGCCAGAATATGAGG - Intronic
1082218238 11:49600853-49600875 GAAAGCAGAGACAAAAGAAAGGG + Intergenic
1082771567 11:57211580-57211602 GATGGCAGAGGCAGAAGAGGTGG - Intergenic
1082877286 11:58001187-58001209 GAAAACAGAGGCTGAAGCTGGGG + Intergenic
1083725030 11:64623444-64623466 GGAAGCAGAGGGAGAAGATGGGG - Intronic
1084494523 11:69496304-69496326 GAAAGCAGAGCTAGAGAAGGAGG - Intergenic
1084719914 11:70898739-70898761 GGAAGCAGAGCTTGAAGATTTGG + Intronic
1084913067 11:72407041-72407063 GAGAGCAGAGAAAGAAAATGTGG - Intronic
1085356564 11:75843544-75843566 GAGAGCAGAGTCAAGAGATGTGG - Intronic
1085412750 11:76301320-76301342 GAACGCAGAGCAGGGAGATGTGG - Intergenic
1085750768 11:79159124-79159146 GAATGCAGAGCTATAAGAGGGGG + Intronic
1086631332 11:89023264-89023286 GAAAGCAGAGACAAAAGAAAGGG - Intronic
1087161554 11:94953101-94953123 GATGGCAGAGGCAAAAGATGTGG + Intergenic
1088341081 11:108767873-108767895 GGTAGCAGAGGCAGAAGAAGTGG - Intronic
1088487583 11:110355565-110355587 AAGAGCAGAGCCAGAAGACGTGG + Intergenic
1088644964 11:111910790-111910812 GAGACCTGAGCCAGAAGAAGAGG - Intronic
1088843112 11:113643230-113643252 AAAAGCGGAGCCAGAAACTGGGG - Intergenic
1089309085 11:117546031-117546053 GCACGCAGAGCCAGAAGCTTTGG + Intronic
1090485903 11:127111871-127111893 GAAATTAGAGCAAGAAGTTGGGG + Intergenic
1090531345 11:127594141-127594163 GAAAGAAGAAAGAGAAGATGTGG - Intergenic
1090661201 11:128882937-128882959 GAAAGTAGAGAAAAAAGATGAGG + Intergenic
1091048623 11:132348237-132348259 GACAGCAGAGCCAGAGGACATGG + Intergenic
1091274605 11:134342047-134342069 GAAAGCCGTGCGAGAAGCTGGGG - Intronic
1092488386 12:8922569-8922591 GAAAGAAGAGACAGAAGAGATGG - Intronic
1092594873 12:9990482-9990504 GGAAGTGGAGCCTGAAGATGTGG + Intronic
1093914763 12:24788992-24789014 GGGAGCAGAGTCAGAAGATGTGG - Intergenic
1095848833 12:46778089-46778111 GAAAGGAGAGAAAGAAGATAAGG + Intronic
1096235282 12:49922203-49922225 GAGAGGAGTGCCAGCAGATGAGG + Intergenic
1096841897 12:54384917-54384939 GAAAGCAAAACCAGAAGAAGAGG - Intronic
1096940370 12:55337918-55337940 CAAACCAGAGCCAGATGATAAGG - Intergenic
1097854337 12:64446441-64446463 GACAGAAGAGAGAGAAGATGAGG - Intronic
1098459254 12:70714359-70714381 AGAAGCAGAGCCAGAAAATCAGG - Intronic
1098536775 12:71602188-71602210 GAAAGCAGAGCCAAGAGGTGAGG - Intergenic
1100154889 12:91786585-91786607 GAAAACAAAGCCAGAAGACTGGG + Intergenic
1100254291 12:92866599-92866621 GAATGCTGAGTCAGAAGAGGAGG - Intronic
1100573504 12:95866035-95866057 GGAAGAAGAGGAAGAAGATGGGG + Exonic
1101055754 12:100911714-100911736 AAGAGCAGTACCAGAAGATGTGG + Intronic
1102239149 12:111312996-111313018 AACAGCAGAGCCAGAATTTGTGG - Intronic
1102783637 12:115586018-115586040 GAAGGCAGAGCCAAGAGAGGGGG + Intergenic
1103387063 12:120541378-120541400 GAAAGCAAAGCAAGAGAATGTGG + Intronic
1104488296 12:129171285-129171307 AGAAGTAGAGCCTGAAGATGGGG - Intronic
1104564091 12:129864618-129864640 GACAGCAGAGACAAGAGATGGGG + Intronic
1105392823 13:19996898-19996920 GAAAGCTGAGCATGAAGGTGTGG + Intronic
1105658656 13:22469001-22469023 GAAAGCACAGCAAGAAGATGTGG + Intergenic
1105817195 13:24047392-24047414 GAATGCAGGGCCACAAGATTAGG - Intronic
1106727962 13:32505468-32505490 GCAACCAGAGCCTGAAGATTCGG - Intronic
1107053886 13:36082158-36082180 GATGGCAGAGTCAGAAGAGGTGG - Intronic
1107069895 13:36257965-36257987 GAAACCAGAACCAGAAGCTGAGG + Intronic
1107481670 13:40790247-40790269 GAAGGGAGAGTCAGTAGATGAGG - Intronic
1108750807 13:53446410-53446432 GAAGGAAGAGCCAGAAGAGCTGG - Intergenic
1108854173 13:54773121-54773143 GAATGCAGAGCAAGAAGACAAGG - Intergenic
1109295837 13:60529821-60529843 GGAAGGAAAGACAGAAGATGAGG + Intronic
1110072871 13:71199942-71199964 GAAAGCAGAGGCAGAAAGGGAGG - Intergenic
1110505917 13:76285736-76285758 TAAAGCAGAGCGAGAGGCTGAGG - Intergenic
1110735644 13:78933278-78933300 AAAAGAAGAGCCAGTTGATGTGG + Intergenic
1110807938 13:79779888-79779910 AAAAGCAGAGCCAGAGGAAAAGG + Intergenic
1111495588 13:89045077-89045099 CAAATCAGGGCCAGATGATGAGG - Intergenic
1112601518 13:100860098-100860120 GAAAGCAGAGGGAGAAGACATGG + Intergenic
1113003490 13:105671783-105671805 GAAGGCTGAGCCAGAAAGTGAGG + Intergenic
1113869425 13:113549146-113549168 GGAAGTACAGCCAGAAGCTGAGG - Intronic
1114032812 14:18590632-18590654 GAAGCCAGAGCCTGGAGATGTGG - Intergenic
1114077601 14:19169679-19169701 GAAGCCAGAGCCTGGAGATGTGG - Intergenic
1114084564 14:19229904-19229926 GAAGCCAGAGCCTGGAGATGTGG + Intergenic
1114568272 14:23648012-23648034 GAAAGCAGAGCCAGATGTCAAGG + Intergenic
1116520120 14:45836183-45836205 GGTGGCAGAGGCAGAAGATGTGG + Intergenic
1116767755 14:49092721-49092743 GAAAGCAGAGCCTGAGGCAGAGG - Intergenic
1117192183 14:53304125-53304147 GGAAACAGAGCCAGAATGTGTGG - Intergenic
1117519689 14:56538591-56538613 AGAAGTAGAGCCTGAAGATGTGG + Intronic
1118035024 14:61857326-61857348 GAAAGCAGAGAGAGATGAGGTGG + Intergenic
1118165067 14:63328148-63328170 CAAAGCAGAGGCAGGAGTTGGGG - Intergenic
1119009648 14:70971640-70971662 GTAAGTAGAGACAGAAGATAGGG + Intronic
1119561544 14:75593897-75593919 GAAAGCAGAGCAGAAAGATTTGG - Intronic
1119810812 14:77517618-77517640 GAACACAGAGCAAGAAGGTGTGG + Intronic
1119859700 14:77927214-77927236 GAAAGCGGAGCCGAGAGATGGGG - Intronic
1119882052 14:78107341-78107363 GAATGCAGAGAAGGAAGATGAGG - Intergenic
1120119728 14:80664467-80664489 CAAAGCAGAGACAGAATATGAGG + Intronic
1121488466 14:94340435-94340457 GAAAGGAGAGACAGAAAATATGG - Intergenic
1122473918 14:101992587-101992609 GAAAGAAGACCCAGAAGAGAGGG - Intronic
1122481575 14:102050800-102050822 GAAAGCGGAGACAGAAGAGGCGG - Intergenic
1123459235 15:20453866-20453888 TAAAGAAGAGCCAGTGGATGTGG - Intergenic
1123658825 15:22546552-22546574 TAAAGAAGAGCCAGTGGATGTGG + Intergenic
1123711087 15:22988251-22988273 GAGAGCAGACCCAGAAAAAGAGG + Intronic
1124054552 15:26230272-26230294 AAAAGCAGAGTCATGAGATGAGG - Intergenic
1124236218 15:27991465-27991487 GAAGCCAGACACAGAAGATGGGG + Intronic
1124265473 15:28229703-28229725 TAAAGAAGAGCCAGTGGATGTGG - Exonic
1124312690 15:28641044-28641066 TAAAGAAGAGCCAGTGGATGTGG + Intergenic
1124492566 15:30167224-30167246 GACAGCAGAGCCAGGTGATAGGG - Intergenic
1124511953 15:30335212-30335234 GACAGCAGAGCCAGAAGTAAAGG - Intergenic
1124730960 15:32195539-32195561 GACAGCAGAGCCAGAAGTAAAGG + Intergenic
1124750968 15:32371101-32371123 GACAGCAGAGCCAGGTGATAGGG + Intergenic
1124871507 15:33547985-33548007 GAATGCAAAGCCAGAATAAGAGG - Intronic
1124955434 15:34357116-34357138 GGAAGCAGAGGAAGAGGATGAGG + Exonic
1125045275 15:35238024-35238046 AAAAGGAGAACCTGAAGATGAGG + Intronic
1125699679 15:41671014-41671036 GGATGCAGAACCAGTAGATGTGG - Intronic
1126215822 15:46153738-46153760 CTAAGCAGTGCCAGAAGATGTGG - Intergenic
1126821604 15:52509796-52509818 GAAATCAGAGGCATCAGATGAGG + Intronic
1127318599 15:57820088-57820110 GAACCCAGAGCCCAAAGATGAGG - Intergenic
1128094627 15:64944304-64944326 GAAATCAGAGCCCAGAGATGGGG - Intronic
1128496624 15:68201880-68201902 GGAAGGAGAGCCAGGAGGTGAGG - Intronic
1128616951 15:69117679-69117701 GAAAACAGAGACAGCAGCTGCGG - Intergenic
1129026371 15:72578059-72578081 CAAACCAGTGCCAGATGATGAGG - Intronic
1129388933 15:75210894-75210916 GAAAGCAGAGGCAGCTGCTGGGG + Exonic
1129454145 15:75667531-75667553 CAATGCAGAGCCAGAGGACGCGG - Intergenic
1129665956 15:77579531-77579553 GAAACAAGAGCCAGGAGAGGTGG + Intergenic
1130056591 15:80531643-80531665 GAAAACAGAACCAAATGATGAGG - Intronic
1130856553 15:87844172-87844194 CAAAACAGAGGCAGAAGAGGTGG - Intergenic
1131406383 15:92168287-92168309 GGAAGCAGGGTGAGAAGATGAGG + Intronic
1131971506 15:97898203-97898225 GAAACCAGAGCCAGACAAGGAGG + Intergenic
1133106181 16:3511222-3511244 AAAATGAGAGCCAGAAGGTGAGG + Intronic
1134429407 16:14187898-14187920 GAAAGCAGAGGCTGAAAAAGGGG - Intronic
1135308930 16:21390289-21390311 TGAAGCAGGGCCAGGAGATGAGG + Intergenic
1136078186 16:27831241-27831263 GAAAGCAGAGCCATGAAAAGGGG + Intronic
1136148514 16:28330591-28330613 TGAAGCAGGGCCAGGAGATGAGG + Intergenic
1136305673 16:29369420-29369442 TGAAGCAGGGCCAGGAGATGAGG + Intergenic
1136711185 16:32238517-32238539 GAATGCAGATCCACAAGAGGAGG + Intergenic
1136756722 16:32690890-32690912 GAATGCAGATCCACAAGAGGAGG - Intergenic
1136764059 16:32760547-32760569 TAAAGAAGAGCCAGTGGATGTGG + Intergenic
1136804040 16:33109839-33109861 TAAAGAAGAGCCAGTGGATGTGG - Intergenic
1136811388 16:33179485-33179507 GAATGCAGATCCACAAGAGGAGG + Intergenic
1136817864 16:33289565-33289587 GAATGCAGATCCACAAGAGGAGG + Intronic
1136824428 16:33346094-33346116 GAATGCAGATCCACAAGAGGAGG + Intergenic
1136829494 16:33444865-33444887 GAATGCAGATCCACAAGAGGAGG + Intergenic
1137447602 16:48541316-48541338 GGAAGCAGAGGTAGAAGACGAGG - Exonic
1137806038 16:51306359-51306381 GAAGGAAGAGACAAAAGATGGGG - Intergenic
1137866671 16:51904422-51904444 GAAAGCAGAACCAAGAGATGGGG + Intergenic
1138023586 16:53504946-53504968 GAAAGCAGAGCCTGAAGACCAGG - Intergenic
1138970366 16:62135761-62135783 AAAACCAGAGACAGGAGATGGGG - Intergenic
1139341740 16:66271910-66271932 GGAACCAGAGCCAGAAGGAGAGG + Intergenic
1139630485 16:68229189-68229211 GGAAGAAGAGCCAGCAGTTGAGG + Exonic
1139804805 16:69555570-69555592 GGAAGAAGAGCCAAGAGATGGGG - Intergenic
1140027289 16:71302072-71302094 GAGAGACGAGCCTGAAGATGAGG - Intergenic
1140615881 16:76663137-76663159 GAAGTCGGAGCCAGAAGATGGGG + Intergenic
1140857665 16:78992024-78992046 GAAAGGAGAGCCTGAAAGTGGGG - Intronic
1140936599 16:79676398-79676420 GAAAGAAGAGTGAGAAGAAGAGG - Intergenic
1141849718 16:86636963-86636985 GAGAGCAAAGCCTGAGGATGAGG + Intergenic
1141976568 16:87520187-87520209 GAAAGCAGAGCCGAGAGAAGGGG - Intergenic
1142205381 16:88780361-88780383 GAAGGCAGATACAGAGGATGTGG + Intronic
1202989966 16_KI270728v1_random:2454-2476 GAATGCAGATCCACAAGAGGAGG + Intergenic
1203058871 16_KI270728v1_random:951242-951264 GAATGCAGATCCACAAGAGGAGG - Intergenic
1143152613 17:4816782-4816804 GAGAGCAGGGTCAGAAGCTGGGG + Intronic
1143180324 17:4980434-4980456 GGAAGAAGAGGAAGAAGATGGGG + Exonic
1143202018 17:5119942-5119964 GAAAGGAGAGGCAGGAGAGGGGG - Intronic
1143882332 17:10039373-10039395 GAAAGCCCACCTAGAAGATGAGG + Intronic
1144018757 17:11221691-11221713 GAAAGTGGAAACAGAAGATGGGG - Intergenic
1144033974 17:11348943-11348965 GAAAGCACAGCCAGATGAGTAGG - Intronic
1144129781 17:12235132-12235154 GAAAGAAGAGCCAAAATATATGG + Intergenic
1144218530 17:13079352-13079374 CAAACCAGACCCAGAAGCTGGGG + Intergenic
1144383704 17:14728711-14728733 GAAAGAGGAGCCTGGAGATGGGG + Intergenic
1144420562 17:15094181-15094203 GAAAGCAGACCCAAGAAATGGGG + Intergenic
1144577266 17:16436940-16436962 GACCCCAGAGCCAGCAGATGTGG - Exonic
1144682522 17:17205286-17205308 GAAAGCAGCGCCAGGACATTCGG - Intronic
1144826396 17:18107925-18107947 GAAAGGAGAGCCAGGAGAACTGG - Exonic
1145105187 17:20109556-20109578 GAAAGCAAAGCCAGAACAGAGGG + Intronic
1145354032 17:22120209-22120231 GAAAGCTGAGGCAGTAGAAGTGG - Intergenic
1146305086 17:31724520-31724542 GAGACCAGAGCCCCAAGATGGGG - Intergenic
1146748322 17:35352209-35352231 GAAAGGAGAGCCAGAAATGGGGG + Exonic
1146756871 17:35440432-35440454 GAAAGGAGAGCCAGAAATGGGGG + Exonic
1147051988 17:37802175-37802197 GAAGGCAGAGCAAGGAGAGGGGG - Intergenic
1147195271 17:38762361-38762383 CAAATCAGAGCCAGAGGCTGTGG + Intronic
1147552949 17:41457526-41457548 GAAAGCTGAGCCAGATCATCTGG + Intergenic
1147581536 17:41629891-41629913 GAAAGGAGAGGCAGGAGAGGGGG + Intergenic
1147663709 17:42131648-42131670 GAAAGAAGAGGCAGGAGGTGTGG + Exonic
1147716463 17:42512076-42512098 GGAAACTGAGGCAGAAGATGTGG + Intronic
1148110120 17:45139555-45139577 GCAAGCAGAGCTAGGAGTTGAGG - Intronic
1148382061 17:47207073-47207095 GAGAGGTGAGGCAGAAGATGAGG + Intronic
1149926339 17:60705678-60705700 CAAACCAGTGCCAGATGATGAGG + Intronic
1150377041 17:64689902-64689924 TTAACCAGAGCTAGAAGATGGGG + Intergenic
1150640921 17:66948877-66948899 GAAGGAAGAGGCAGAAGAGGAGG - Intergenic
1151400658 17:73853783-73853805 GAAATCATACCCAGGAGATGGGG - Intergenic
1153104849 18:1514465-1514487 GGAAGCAGAGCCAGAAATTATGG - Intergenic
1155075427 18:22349721-22349743 GAAAACAGAATCAGAAAATGAGG - Intergenic
1155228769 18:23753626-23753648 GGAAGCAGAGGCAGCAGATGTGG + Intronic
1156263692 18:35467549-35467571 GAAAGGATGGCCAGAAGAGGTGG - Intronic
1156958778 18:42997449-42997471 GAAAGAAGAGAGAGAAGAAGGGG + Intronic
1157573312 18:48727824-48727846 GAAAGCATAGTCCAAAGATGAGG - Intronic
1157718875 18:49908075-49908097 TTAAGCAGAGCCAGAGGCTGGGG + Intronic
1158422731 18:57310445-57310467 GAAAGGAGAGCAAAAACATGAGG + Intergenic
1158559452 18:58501634-58501656 GAATTCAGAGTCAGAAAATGCGG + Intronic
1158960884 18:62586939-62586961 GAAAGCAGAGCCCGAAAAGGAGG - Intronic
1158966305 18:62625080-62625102 GAAATCAGAGCCAGAGGAAATGG + Intergenic
1160533765 18:79580438-79580460 AACAGCAGAGTCAGAAGTTGAGG + Intergenic
1160611983 18:80095993-80096015 GGAAGCAGAGCTAGAAAATAGGG - Exonic
1162298562 19:9830017-9830039 GAAAGCGGGGCAGGAAGATGAGG - Exonic
1163320015 19:16569126-16569148 GAAAGCTGAGGCAGAAGAATCGG - Intronic
1163564841 19:18044991-18045013 GGCAGCAGGGCCAGGAGATGGGG - Intergenic
1163605777 19:18274528-18274550 GAAGGCACAGCCAGAGGTTGGGG + Intergenic
1164638103 19:29806165-29806187 GAAAGCAGAGCCAGAGGTTCTGG - Intergenic
1164972901 19:32547734-32547756 GAGAGCAGAGCCAGGAGGTGGGG - Intergenic
1165543928 19:36517473-36517495 TAAAGAAAAGCCAGCAGATGTGG + Intronic
1165945576 19:39439820-39439842 GGGAGCAGAGCCAGCAGACGGGG + Intronic
1166054063 19:40278178-40278200 GCAGGCAGGGCAAGAAGATGAGG + Intronic
1166165220 19:40983014-40983036 GCAGGCAGAGACAGCAGATGTGG + Intergenic
1166749344 19:45157367-45157389 TAAAGCAGGGACAGGAGATGGGG - Intronic
1167609168 19:50498183-50498205 AGAGGCAGAGACAGAAGATGGGG + Intergenic
1167718667 19:51161975-51161997 GGAAGCAGAGCCTGCAGAAGAGG + Intergenic
1167766339 19:51485200-51485222 GGAAGCAGAGCCAGAAGGGGAGG + Intronic
1167859848 19:52273791-52273813 TAGAGCAGAGCCAGAAGGTGGGG + Intronic
1167868097 19:52344454-52344476 GAGAGACGAGCCAGAAGGTGGGG + Intronic
1167880870 19:52456267-52456289 GAGACCAGAGCCAGAAGATAGGG + Intronic
1167886103 19:52501245-52501267 GAGGGCAGAGCCAGAACGTGGGG + Intronic
1167888086 19:52518343-52518365 GAGGGCAGAGCCAAAACATGGGG + Intergenic
1167896725 19:52587668-52587690 GAGAGCAGAATCAGAAGGTGGGG + Intergenic
1167906047 19:52661675-52661697 GAGAGCAGAGCCAGAAGGTGGGG - Intronic
1167912625 19:52716470-52716492 GAGGGCAGAGCCAGAACATGGGG - Intronic
1167920508 19:52779457-52779479 GAGGGCAGAGCCAGAACGTGGGG - Intronic
1167921896 19:52788955-52788977 GAGAGCAGAGCCAGAAGGTGGGG - Intronic
1167927597 19:52834187-52834209 GAGGGCAGAGCCAGAATGTGGGG - Intronic
1167932134 19:52874609-52874631 GAGAGCAGAGCCAGAAGGTGGGG - Intronic
1167945058 19:52981516-52981538 GAGAGCAGAGCCAGAAGGTGGGG - Intergenic
1167958443 19:53086887-53086909 GAGAGCAGAGCCAGAAGGTGGGG - Intronic
1167970018 19:53183520-53183542 GAAAGTACAGCCAGAAGGTGGGG - Intronic
1168485255 19:56756143-56756165 GAAAGCAGAGTGAGAACAGGCGG + Intergenic
925095103 2:1192165-1192187 GGAGTCAGAGCCAGATGATGTGG + Intronic
925739712 2:6994982-6995004 GAAAGCTCACCCAGCAGATGGGG - Intronic
926175362 2:10586622-10586644 GAAGGCAGAGTCAGAAGAGGAGG - Intronic
926202296 2:10810710-10810732 GAAAGAACAGACAAAAGATGTGG + Intronic
926350924 2:11993814-11993836 GGAACCAGAACCTGAAGATGTGG + Intergenic
926405297 2:12545590-12545612 GAGAGTAGGGCCAGAAGAGGAGG + Intergenic
926737264 2:16083092-16083114 GAAAGTTGAGCCAGGAGTTGGGG - Intergenic
927696922 2:25245336-25245358 GAAAGCAGAGGGAGGGGATGGGG + Intronic
927826869 2:26315444-26315466 GAAAGCAGAGAAGGAAGACGAGG + Intronic
927957272 2:27216679-27216701 GAAAGGAGAGCCACAAGACCAGG + Intronic
928061847 2:28121667-28121689 TAAAGCAGAGAAAGAAGATAAGG - Intronic
928274309 2:29885685-29885707 CAAACCAGTGCCAGATGATGAGG + Intronic
929019864 2:37541724-37541746 GAAAACAGAGCCAGAGAATAAGG - Intergenic
929215624 2:39408773-39408795 TAAAGCAGTGCCAGACGATGAGG + Intronic
929250169 2:39745109-39745131 GAAAGTACATCTAGAAGATGTGG - Intronic
929912671 2:46104167-46104189 CAAAGCAATGCCAGATGATGAGG - Intronic
931791199 2:65665804-65665826 GAAAGCAGAGAGAGGAGAGGAGG - Intergenic
932116873 2:69058975-69058997 TGAAGCGGAGCCTGAAGATGTGG + Intronic
932440551 2:71731897-71731919 GCATGGAGAGCCAGGAGATGAGG - Intergenic
934052729 2:88223873-88223895 GAAAGTGGAGCCAAAGGATGAGG - Intergenic
934530813 2:95087449-95087471 GGATCCAGAGCCAGAAGATGAGG - Exonic
935473628 2:103490476-103490498 GGAACCAGTGCCAGATGATGAGG + Intergenic
935591027 2:104845313-104845335 GGAAGGAGGCCCAGAAGATGGGG + Intergenic
935785540 2:106545260-106545282 GAAAGCAGACCCTGGCGATGTGG + Intergenic
936501860 2:113072832-113072854 GAATGCTGAGTCAGAGGATGAGG + Intronic
936645868 2:114370000-114370022 GGAAGCAGAGGCAGATGAAGAGG - Intergenic
937765231 2:125653164-125653186 GAAAGAAGAGTCAGAACAAGAGG - Intergenic
937976478 2:127584975-127584997 GAAAGCAGGCTCAGAGGATGAGG + Intronic
938576602 2:132609963-132609985 CCAAGCAGAGACAGAAGTTGGGG - Intronic
938825321 2:134999037-134999059 GACTGGAGATCCAGAAGATGTGG - Intronic
939412181 2:141842327-141842349 GAAAGAAGAGCCTAAAGATTAGG + Intronic
939773004 2:146347491-146347513 AAGAGCAGAGCCAGAGGCTGGGG + Intergenic
939853356 2:147326594-147326616 GATAGCAGAGGCAGAAGAGGTGG - Intergenic
940845238 2:158633605-158633627 GAAAGCAAAACCAAAAGATAAGG + Intronic
941144316 2:161824599-161824621 TAAACCAGCGCCAGAAGATAAGG + Intronic
941295590 2:163735482-163735504 GAAAGCGGAGCCATAGGGTGGGG - Intronic
942230882 2:173860084-173860106 GTAAAGAGAGCCAGAAAATGAGG + Intergenic
942415701 2:175757038-175757060 GAAAGCAGGGCTTAAAGATGTGG + Intergenic
942699765 2:178692542-178692564 GAAACCAGCTCCAGAAGAAGTGG - Exonic
942918399 2:181341080-181341102 GAAATTAGATCTAGAAGATGTGG + Intergenic
943012562 2:182468458-182468480 AAAAATAGAGCCTGAAGATGTGG - Intronic
943095454 2:183422922-183422944 CAAAGCAGAGCCAGAAAATTAGG - Intergenic
943103510 2:183514235-183514257 AAGAGCAGAGGCAGAAGAGGTGG - Intergenic
943761690 2:191616992-191617014 GTAAGTAGAGCCAGACAATGGGG + Intergenic
943997885 2:194795431-194795453 GAAAGCAGAGACAGAATTAGGGG - Intergenic
944145124 2:196499104-196499126 GCAAGCTGAGCAAGGAGATGGGG - Intronic
944622623 2:201532502-201532524 CAAAGAAGAGCCCCAAGATGTGG + Intronic
944871208 2:203913974-203913996 GAAAGCAGCAGCAGAAGAAGAGG - Intergenic
944880117 2:204004402-204004424 GAAAGAAGAGAAAGAAGATGAGG + Intergenic
944987165 2:205190577-205190599 GGGACCAGAGCCAGAAGATCTGG - Intronic
945620904 2:212135880-212135902 TCAAGGAGAGCCAGATGATGGGG - Intronic
945625231 2:212196409-212196431 GATGGCAGAGGCAGAAGAAGGGG + Intronic
946045308 2:216816087-216816109 GGAAGCAGAGACAGAGCATGAGG - Intergenic
946209426 2:218135572-218135594 GCCAGCAGAGCAGGAAGATGAGG - Exonic
946320370 2:218950586-218950608 GAAAGCAGAGTCAACAGATGGGG - Intergenic
946508335 2:220325702-220325724 GAAAGCAGAGTCATTAGAAGAGG + Intergenic
946853336 2:223929015-223929037 GAAGGCAGAGCCAGCAGAGCTGG + Intronic
946896486 2:224329246-224329268 GGAAGCAGAGCCAGAGGAGTTGG + Intergenic
946975748 2:225148256-225148278 GAAAGCAGTGCAGGAATATGAGG - Intergenic
947144999 2:227056080-227056102 GAAAGGACAGCCGGGAGATGTGG - Exonic
947495489 2:230632934-230632956 GAAAGAAGCGGCAGGAGATGTGG + Intergenic
948087394 2:235262967-235262989 GAAAACAGAGCCAAGACATGGGG + Intergenic
1169206353 20:3742348-3742370 GAAAGCATAGCCACTAGACGTGG - Exonic
1171288870 20:23968273-23968295 GAAAGCATAGCCTAAAGATGAGG + Intergenic
1172328211 20:34054027-34054049 GAAGGCAGAGTGAGAAGCTGGGG - Intronic
1172755265 20:37279484-37279506 TAAATCAGTGCCTGAAGATGTGG + Intergenic
1173254072 20:41380968-41380990 GAGAGCAGAGCCAGCAGCTTTGG - Intergenic
1173327974 20:42050874-42050896 AAAAGCAGGGCCAGGAGCTGTGG + Intergenic
1173339142 20:42138261-42138283 GAAAGCACAGGCAGAAGATTGGG + Intronic
1173493661 20:43503559-43503581 GGAACCAGAGCAATAAGATGTGG - Intergenic
1174038073 20:47680388-47680410 GAAACAAGAGCCAGGAGAGGTGG - Intronic
1174176849 20:48650688-48650710 GAAAACGAAGCCAGGAGATGCGG + Intronic
1174520389 20:51125360-51125382 GGTGGCAGAGGCAGAAGATGGGG - Intergenic
1174769036 20:53281160-53281182 GAATGCTGAGCCAAAAAATGGGG + Intronic
1175060207 20:56235009-56235031 ACAGGCAGAGGCAGAAGATGAGG - Intergenic
1175336078 20:58197155-58197177 GAGAGGAGGGCCAGAAGAGGTGG - Intergenic
1175531158 20:59674877-59674899 GAAGGCAGAGACAGGAGAAGCGG - Intronic
1175739795 20:61412648-61412670 GAAGGCAGAGCTGGAAGGTGGGG - Intronic
1175767795 20:61603294-61603316 GAAAACAAAGCCAGGTGATGGGG + Intronic
1175820326 20:61905617-61905639 GCCAGCAGAGGCAGAAGGTGTGG - Intronic
1176145996 20:63565812-63565834 GAAGGCAGAGCCGGGAGATGAGG - Exonic
1177877912 21:26657137-26657159 CAAATCAGTGCCAGATGATGAGG + Intergenic
1177892761 21:26826443-26826465 GAAACCAAAGCCAGGGGATGAGG + Intergenic
1177894514 21:26844306-26844328 GAAAGCGGAGACCGAAGACGAGG - Exonic
1177928345 21:27248155-27248177 GAAGGTAGAGGCAGAAGAGGTGG - Intergenic
1178640096 21:34338476-34338498 GGAAGCAGAGCCAGAGGACCAGG + Intergenic
1178891227 21:36522630-36522652 GAGAACAGCGCAAGAAGATGCGG + Intronic
1179088787 21:38244494-38244516 GAAAGCACTCCCAGGAGATGCGG - Intronic
1180085929 21:45507897-45507919 GAAGGCAAAGACACAAGATGTGG - Intronic
1180293405 22:10863297-10863319 GAAGCCAGAGCCTGGAGATGTGG - Intergenic
1180456927 22:15517688-15517710 GAAGCCAGAGCCTGGAGATGTGG - Intergenic
1180496211 22:15892713-15892735 GAAGCCAGAGCCTGGAGATGTGG - Intergenic
1181009873 22:20033789-20033811 GAATGCAGTGCAGGAAGATGGGG - Intronic
1181296411 22:21843344-21843366 GACATCAGAGGCAGAAGAAGGGG + Intronic
1182297223 22:29316622-29316644 GAGAGCAGAGGCGGAGGATGGGG - Intronic
1182356466 22:29724374-29724396 GATAGCAGAGCCAGAAGAAGAGG - Intronic
1182468151 22:30530943-30530965 GTGAGCAGAGCCAGAATATGAGG + Intronic
1184345188 22:43908817-43908839 GAAAGCAGGGAGAGAGGATGAGG + Intergenic
1184816549 22:46876190-46876212 GAAAGCACAGGCAGAATCTGGGG - Intronic
1184987331 22:48144737-48144759 CACAGCTGACCCAGAAGATGCGG - Intergenic
949728799 3:7082855-7082877 AAAAGTGGAGCCTGAAGATGTGG + Intronic
949762524 3:7487266-7487288 GAAAGCAGAGTCTGAAAATTTGG + Intronic
949919840 3:8991935-8991957 GAAAAGAGAGGCAGAAGATATGG + Intronic
950198425 3:11026061-11026083 GAGGGCAGAGCCAGAAGATCAGG - Intronic
950947223 3:16961669-16961691 GAAAGCAGCACCAGAAGCAGAGG + Intronic
951926653 3:27915255-27915277 GAAAGAAGAGACAAGAGATGGGG - Intergenic
952169304 3:30788574-30788596 GAAAGCAGAGTCAGGCAATGTGG - Intronic
952367260 3:32685611-32685633 GACAGCCGAGACAGAGGATGGGG - Intronic
952451533 3:33438602-33438624 CAAATCAGAGCCAGACGCTGGGG + Intronic
952956371 3:38560347-38560369 TGAAGATGAGCCAGAAGATGAGG + Exonic
952977975 3:38712364-38712386 TGAAGATGAGCCAGAAGATGAGG + Exonic
954343379 3:49974182-49974204 AAAAGCAGGGCCAGAAGCGGTGG - Intronic
954516102 3:51178559-51178581 GAAAGCAGAGCCAGAGCTGGGGG + Intronic
954521368 3:51229486-51229508 GAAAGCAAGCCCAAAAGATGAGG - Intronic
954750332 3:52810029-52810051 AACAGCAGAGGCAGAGGATGTGG - Intergenic
955540746 3:59973449-59973471 GAAGGCAGAGACAGAGGTTGGGG - Intronic
955957323 3:64304124-64304146 GAAAACAGAGCATGTAGATGCGG - Intronic
955993954 3:64658737-64658759 AAAACCAGAGCAAGAAAATGGGG - Exonic
959229351 3:103628641-103628663 GAAAGTTGAGCAAGAATATGTGG - Intergenic
959587530 3:108039026-108039048 GAAGGCAGAGTCATAAAATGTGG + Intergenic
959773183 3:110124610-110124632 CAAACCAGTGCCAGATGATGAGG - Intergenic
960061769 3:113330233-113330255 AAAAGCAGAGCCAACGGATGTGG - Exonic
960423310 3:117475898-117475920 GAATGGAGAGCCACAAGATGTGG + Intergenic
961625143 3:128256603-128256625 AAAAGCACAGCCTGAAGAAGTGG - Intronic
961831055 3:129623254-129623276 GTCGGCAGAGCCAGCAGATGAGG - Intergenic
962007034 3:131360078-131360100 GAAAGAACAGCCTGAAGATCTGG + Intergenic
962050313 3:131806729-131806751 GAAACCAGAGCAAGAAAATGAGG - Intronic
962783547 3:138744812-138744834 TGAAGCAGTGCCAGATGATGAGG - Intronic
963072230 3:141313637-141313659 GACAGGAGAGCCACAAAATGTGG - Intergenic
963247019 3:143072982-143073004 GGAAGCAGAGCCAAAAAATGGGG + Intergenic
963254751 3:143133767-143133789 GAGAGCAGAGCCAAAAGATACGG + Intergenic
963349984 3:144140011-144140033 GTCAGCAGAGCCTGAGGATGAGG + Intergenic
964644801 3:158947522-158947544 GAAAGGAGGGCAAGGAGATGGGG + Intergenic
966002745 3:174970598-174970620 TAAAGAAGAGACAGAAGCTGTGG + Intronic
966242416 3:177769188-177769210 GAAAGCAGAGTAAAAAGATATGG - Intergenic
966251784 3:177874256-177874278 AAAAGTAGAGCAGGAAGATGCGG + Intergenic
967298345 3:187987307-187987329 GCAAGCAAAGCCAGAAGATGAGG - Intergenic
967322484 3:188208332-188208354 GCAGGCTGAGCCAGCAGATGAGG - Intronic
967866150 3:194191672-194191694 GTAAGCAGAGCTATAGGATGGGG + Intergenic
969149295 4:5154993-5155015 GAAAGCAGAGTCAGAAAAACAGG - Intronic
969196878 4:5570054-5570076 GACACCTGACCCAGAAGATGGGG - Intronic
969476084 4:7423061-7423083 GGAATCAGAGCCAGCAGATCAGG - Intronic
970720049 4:18976282-18976304 GCAAGCAGAGCCAAAGGCTGCGG + Intergenic
971055908 4:22912121-22912143 GTAAGCAGAGCTGCAAGATGTGG + Intergenic
971088840 4:23315429-23315451 GAAAGCAGAGGAAAAAGAAGAGG - Intergenic
971132299 4:23826189-23826211 GAAATGAGAGCCATAAGAAGGGG + Intronic
971621575 4:28860758-28860780 CAAACCAGTGCCAGATGATGAGG - Intergenic
972479292 4:39482764-39482786 GACAGCAGAGCGACCAGATGAGG + Intergenic
972511342 4:39770839-39770861 GAAAGCCGAGGAAGAGGATGAGG - Intronic
973026153 4:45274848-45274870 GAAAAAAGAGGAAGAAGATGAGG + Intergenic
975506547 4:75144539-75144561 GCTAGAAGAGCCAGGAGATGGGG + Intergenic
975643490 4:76524185-76524207 GGAAGAAGAGTCAGCAGATGGGG + Intronic
975959462 4:79884315-79884337 GAAATCAGCTCCAGAAGATTAGG + Intergenic
976072274 4:81255487-81255509 GTAGGCAGAGCTGGAAGATGTGG - Intergenic
976165120 4:82246416-82246438 GACAGGAGATCCAGAAGGTGTGG - Intergenic
978041008 4:104061910-104061932 CAAAGAAGAGGGAGAAGATGAGG - Intergenic
978134310 4:105238621-105238643 AGAAGTAGAGCCTGAAGATGGGG - Intronic
978220376 4:106265764-106265786 AAAAACAGAGCCTGGAGATGGGG - Intronic
978429967 4:108623349-108623371 GAAAGAAAAGCCAGATTATGAGG + Intronic
978763482 4:112380325-112380347 GAAAGCAGACCCACAGGATTAGG - Intronic
979101617 4:116623722-116623744 GAAATATGAGCCAGAAAATGGGG + Intergenic
979313108 4:119227524-119227546 GGAAGCTGAGCCAGGAGAAGTGG + Intronic
979356181 4:119708350-119708372 GAAAACAAAGCAAGAAGTTGTGG - Intergenic
979664488 4:123295570-123295592 CAAAGCAGAGCCAGACGCCGTGG + Intronic
980235757 4:130103874-130103896 GTAGGCAGAGCCAGATCATGTGG + Intergenic
980546939 4:134276473-134276495 CAAACCAGTGTCAGAAGATGAGG - Intergenic
980753741 4:137128570-137128592 GAAATCAGAGCCAGAAGACTGGG - Intergenic
980835729 4:138189456-138189478 GAACTCAGGGCCAGAAGAGGTGG - Intronic
981350794 4:143727287-143727309 GACAGTAGAGCTGGAAGATGTGG - Intergenic
981416802 4:144503336-144503358 GGAAGCAGAGGAAGAAGAAGAGG + Intergenic
981985707 4:150852631-150852653 GAAAGCTGAGCAAGAAAATCAGG - Exonic
982031548 4:151306864-151306886 GGATGCAGAGCCTGAACATGAGG - Intronic
982635820 4:157895476-157895498 GCAAGCAGAGCCAGAATCAGAGG + Intergenic
983113246 4:163780204-163780226 GAATGCAGAGCCCCAAGAAGGGG + Intronic
983671996 4:170248122-170248144 GATAGTAGAGGCAGAAGAGGTGG + Intergenic
984345402 4:178517041-178517063 GAAAGCAGAACTAGAATATATGG - Intergenic
984474395 4:180217333-180217355 GAAACCAGAGCCAGAAGCTGAGG + Intergenic
984494194 4:180473959-180473981 GGAAGCAGAGACAGAAGAGATGG - Intergenic
984753366 4:183300049-183300071 GGAAGCAGAGCAAGAAGCTGAGG + Intronic
984841575 4:184073105-184073127 GGTAACAAAGCCAGAAGATGAGG + Intergenic
984891488 4:184498113-184498135 GAAACCAGAACAAGAAGCTGAGG + Intergenic
985348622 4:189034420-189034442 GAAAGCAGAAGCAGGAGTTGTGG + Intergenic
986021900 5:3812386-3812408 GGAAGCAGAGCCAGATGGTGTGG + Intergenic
986509288 5:8486478-8486500 CAAACCAGTGCCAGATGATGAGG + Intergenic
987167699 5:15218648-15218670 ACACACAGAGCCAGAAGATGGGG - Intergenic
987994651 5:25261196-25261218 GGAGGCAGAGGCAGAAAATGTGG - Intergenic
988395948 5:30698229-30698251 GAAAGCAGAGCATAAAGATTTGG + Intergenic
989518624 5:42374576-42374598 CAAATCAGAGACTGAAGATGAGG + Intergenic
990223040 5:53617248-53617270 GAAAGGAGAGGCAGAACAAGAGG - Intronic
990452588 5:55949956-55949978 TACAGAAGAGCCAGATGATGAGG + Intronic
991007619 5:61845452-61845474 GGAAGCAGAGCAGAAAGATGTGG + Intergenic
991270038 5:64768673-64768695 GACGGCAGAACCAGTAGATGCGG + Exonic
992170123 5:74093205-74093227 GAAAGGAGAGCCAGAAAAACAGG - Intergenic
992809945 5:80376638-80376660 GAAGGCAGAGCCAGGAGCTTTGG + Intergenic
995035156 5:107525752-107525774 GATGGCAGAGGCAGAAGAGGTGG + Intronic
995438374 5:112162577-112162599 CAAAGCAAAGGCAGAAGATATGG - Intronic
995526381 5:113053641-113053663 GAAAGCAGGTCCAGCAGATAAGG - Intronic
995834019 5:116382690-116382712 GGAAGGAGAGCCAGAGGAAGTGG + Intronic
995938639 5:117550696-117550718 GAAAGAGGAGGAAGAAGATGAGG + Intergenic
996450502 5:123617587-123617609 GAAAGCAAAACCAAAAGATATGG - Intergenic
997732367 5:136191088-136191110 GAAGGAAGAGCCTGAAGATCAGG - Intergenic
997819751 5:137054478-137054500 GAAAGCAAAGGCAGCACATGTGG + Intronic
998152168 5:139763724-139763746 GAGAGCAAAGGCAGAAGATGTGG - Intergenic
998165995 5:139844236-139844258 GAGAGCAGAGCCAGGAGCTCTGG + Exonic
998738050 5:145165605-145165627 CAAAGCAGACCCAGAAGATAGGG - Intergenic
999328461 5:150657556-150657578 GACAGCAGAGCCAGGAGGGGAGG - Intronic
999375963 5:151086812-151086834 GAAGGCAAGGCCAGAAGAAGAGG + Intronic
999594588 5:153188583-153188605 GAAAGCAGAACAGAAAGATGTGG - Intergenic
999722406 5:154408602-154408624 GCAAGCAGAGGCAGCAGGTGAGG - Intronic
999850193 5:155529410-155529432 GAAATCAGAGCCAAGTGATGGGG - Intergenic
1000028041 5:157377083-157377105 GAAAGCAGGGCCAGGAGTAGCGG - Intronic
1000103055 5:158035246-158035268 GAAAGCAGAGCATAAAGATTTGG + Intergenic
1000128450 5:158270725-158270747 GAAAACAGAGGCAGAGCATGGGG + Intergenic
1000806634 5:165802347-165802369 GACTGCAGAGGCAGAAAATGGGG + Intergenic
1000807910 5:165820015-165820037 GAAAGCAGAAACAAGAGATGAGG - Intergenic
1000811124 5:165863329-165863351 AAAAGCAGAGCAAGGAGGTGTGG - Intergenic
1001216869 5:169864377-169864399 GGAAGCAGAGCCAGTTGAGGAGG - Exonic
1001776451 5:174332384-174332406 GAAAGCAGAGCCATATTGTGAGG - Intergenic
1002765633 6:236290-236312 GAGAGCAGAGAGAGAAGAGGTGG + Intergenic
1003146545 6:3514869-3514891 GAGAGCACAGCAAGAAGCTGGGG + Intergenic
1003459434 6:6316904-6316926 GAGAGCAGAGGCAGAAGACCTGG - Intronic
1004435656 6:15590463-15590485 GAAAGCAGAGCCAGTGGATGAGG - Intronic
1004943550 6:20586892-20586914 CAAAGAAGAGCAAGAAAATGAGG - Intronic
1005983510 6:30855604-30855626 GAATGCTGACCCAGCAGATGTGG + Intergenic
1006136796 6:31900708-31900730 GAAAGCCGAGGAAGAGGATGAGG - Exonic
1006218917 6:32471247-32471269 AAATGCAGAGGCAGAGGATGAGG - Intergenic
1006224773 6:32527990-32528012 AAATGCAGTGGCAGAAGATGAGG - Intronic
1006229489 6:32570991-32571013 AAATGGAGAGGCAGAAGATGAGG - Intronic
1006231100 6:32587495-32587517 AAATGGAGAGGCAGAAGATGAGG - Intronic
1006671904 6:35734974-35734996 GAAGGCAGAACCAGAAGAAATGG + Intergenic
1006945175 6:37779844-37779866 GAGAGCAGGGACAGGAGATGGGG - Intergenic
1007494820 6:42252511-42252533 CAAAGGAGATCCAGAAGATAGGG + Intronic
1007938996 6:45759141-45759163 GAAAGGAAAGCCATAAAATGAGG + Intergenic
1008513412 6:52298006-52298028 GAAAGAAGAGACAGAAGAAAAGG + Intergenic
1009294692 6:61931812-61931834 GATGGCAGAGGCAGAAGAGGTGG - Intronic
1009574218 6:65430994-65431016 GAAAGCAGAGGAAAAAGAAGAGG + Intronic
1009936510 6:70240917-70240939 GAGAGGAAAGCCAGAAGGTGAGG + Intronic
1010561468 6:77356903-77356925 CAAAGCAGAGTCAGAAAATCAGG + Intergenic
1011292237 6:85788869-85788891 GAAGGCAGAGGCAGAAATTGGGG + Intergenic
1012106041 6:95159645-95159667 CAAACCAGTGCCAGATGATGAGG - Intergenic
1012378530 6:98591228-98591250 GAAAGCAGAGCCATATGCTCAGG - Intergenic
1015041057 6:128719327-128719349 GAAAGCAGTCCCAGAAAAGGTGG - Intergenic
1015900825 6:138063808-138063830 GAAATAAGAGCAAGAGGATGAGG + Intergenic
1016486230 6:144542656-144542678 GAAGGTAGAGCCAGAAGTTTAGG + Intronic
1017473663 6:154766226-154766248 GATGGCAGAGGCAAAAGATGTGG + Intronic
1017799031 6:157875480-157875502 GAAAGAAGAGGAAGAAGAGGAGG + Intronic
1018362608 6:163087219-163087241 GAGACCAGAGAGAGAAGATGAGG + Intronic
1018773689 6:166994882-166994904 GAACCCAGTGCCAGACGATGAGG - Intergenic
1018936185 6:168275406-168275428 GAAAGCAGGGCCTGGAGAGGAGG - Intergenic
1019006336 6:168799814-168799836 GAAACCAGAGCCAGCGGGTGGGG - Intergenic
1019874422 7:3796548-3796570 GAAAGTGGAGCCAGCAGGTGGGG - Intronic
1020081377 7:5287776-5287798 GAAAGCAGAGAGAGCAGGTGAGG - Intronic
1021271365 7:18590803-18590825 GAAGGCATAGTCAGGAGATGTGG - Intronic
1021638296 7:22712850-22712872 GATAGAAGAGCCAGGGGATGAGG + Intergenic
1021826143 7:24553550-24553572 GAAAGCAGAGGCCATAGATGGGG + Intergenic
1021908479 7:25360460-25360482 CTCAGCAGAGCCAGGAGATGAGG + Intergenic
1021984391 7:26084929-26084951 GAAAGGAAAGCCAGTAGCTGGGG + Intergenic
1022334750 7:29411758-29411780 GAAAGTAGAGCCTGGAGATGGGG + Intronic
1022768673 7:33445060-33445082 GAAAGGAGAGGAAGAAGAAGAGG + Intronic
1023087117 7:36582135-36582157 GAAAGGAGAGCAAGAGGAAGAGG - Intronic
1023215179 7:37854683-37854705 TAAAGCAGTGCCAGACGATGAGG - Intronic
1023329426 7:39099016-39099038 GAAAGCAAAGACTGAAGAAGGGG - Intronic
1023814693 7:43940676-43940698 GAGAGCAGAGTCAGAAGAGAAGG - Intronic
1024295336 7:47837270-47837292 GATAGCAGAGCCAGAGAGTGTGG - Intronic
1024301053 7:47888122-47888144 TAAAGCTGACCCAGGAGATGTGG + Exonic
1024540312 7:50470625-50470647 GAAAACAGTGCCAGAACATCTGG - Intronic
1025197534 7:56944372-56944394 GAAAGCAGAGAGAGCAGGTGAGG + Intergenic
1025674413 7:63632567-63632589 GAAAGCAGAGAGAGCAGGTGAGG - Intergenic
1026963250 7:74423267-74423289 AAAAGCAGAGCCAGAGAATTTGG + Intergenic
1027381574 7:77615816-77615838 TAAAAGAGAGTCAGAAGATGTGG + Intronic
1027930930 7:84534056-84534078 GAATGCAGAGTAAGAAGTTGTGG + Intergenic
1028151476 7:87378516-87378538 GAAAGCAGTACCAAAAAATGGGG - Intronic
1028559381 7:92157184-92157206 AAAAGCAAAGCAAGCAGATGTGG - Intronic
1028713456 7:93937205-93937227 GAAAGAAGAGAAAGAAGAAGAGG - Intergenic
1029549884 7:101232175-101232197 GAACCCAGGGTCAGAAGATGAGG + Exonic
1030251583 7:107451290-107451312 CAAACCAGTGCCAGAAGATAAGG + Intronic
1030290810 7:107870993-107871015 CAACACAGAGACAGAAGATGCGG + Intergenic
1031115805 7:117667066-117667088 GAAAGAGGAGACAGAAGAAGAGG + Exonic
1031289070 7:119909123-119909145 GACAGCAGAAACAGAAAATGAGG + Intergenic
1031537414 7:122952425-122952447 GGTAGCAGAGGCAGAAGAGGAGG + Intergenic
1031957836 7:127960117-127960139 GAAAGCAGCGACAGAAGCAGAGG - Intronic
1032576471 7:133060286-133060308 GAAGGAAGTGCCAGAAGAGGAGG + Intronic
1032628098 7:133614927-133614949 CAAAACAGTGCCAGATGATGAGG + Intronic
1033033701 7:137850746-137850768 GAGAGCTGAGTCAGAAGGTGAGG - Intergenic
1033187698 7:139243921-139243943 GAAAGTAGAGCCAAATGAGGAGG + Intronic
1033609513 7:142952533-142952555 GAAAGCTCAGCCAGAAACTGCGG - Exonic
1035534747 8:382389-382411 GAAAGTAGTGGCAGAAGAGGCGG - Intergenic
1035985771 8:4429973-4429995 GGAAGCTGAGCTGGAAGATGAGG + Intronic
1037438044 8:18885127-18885149 GAAAGGAGAAGCACAAGATGTGG - Intronic
1037841596 8:22249045-22249067 GAAAGAGGAGCCACGAGATGAGG + Exonic
1038137159 8:24799255-24799277 AAAAGCAGAGGCAGAAGAATGGG + Intergenic
1038621611 8:29148721-29148743 GAAAGCAGAACGAGAGGATGAGG - Exonic
1039985514 8:42444503-42444525 GAACGGAGAGACAGAGGATGGGG + Intronic
1040592780 8:48810420-48810442 GAAAGGAGAGCAATAAGAAGTGG - Intergenic
1041123370 8:54609585-54609607 GAAAGGAGGACCAGAAGAGGAGG - Intergenic
1041477290 8:58280561-58280583 AGAGGCAGAGCCAGAAAATGTGG - Intergenic
1041611351 8:59853603-59853625 CAAACCAGTGCCAGATGATGAGG - Intergenic
1041614927 8:59895222-59895244 GACACCAGAGGCAGAAGAGGTGG + Intergenic
1041725706 8:61015654-61015676 GAAAGCAGAGCAAAAGGGTGGGG + Intergenic
1041850221 8:62382693-62382715 CAAACCAGTGCCAGAAAATGAGG - Intronic
1043222127 8:77679825-77679847 GAAAGCAGACCTAGAAAAAGAGG + Intergenic
1044473176 8:92595858-92595880 AAAAGCAGAGTCAGGAGATGAGG + Intergenic
1045204283 8:100021298-100021320 TAAAGCTGAACCAGAAGAGGAGG + Intronic
1046000135 8:108410478-108410500 GGTAGCAGAGGCAGAAGATGTGG + Intronic
1046339593 8:112835801-112835823 GGAATCAGAGCCAGAAGCTGTGG + Intronic
1046545394 8:115643251-115643273 GAAAGAAGAGTCAGTTGATGTGG - Intronic
1047915942 8:129583826-129583848 CAAATCATAGCAAGAAGATGAGG + Intergenic
1047919302 8:129617378-129617400 GAAAACAGAGACAGAAGAGTAGG + Intergenic
1048165924 8:132061368-132061390 GAAGGGAGAGGGAGAAGATGAGG - Intronic
1048444150 8:134480791-134480813 GAGTGCAGAGTCAGAAGAGGTGG - Intronic
1049037247 8:140086319-140086341 GCAAGAAGAGACAGAAGAAGCGG + Intronic
1049396053 8:142401440-142401462 TAAAGCAGGGACTGAAGATGTGG + Intronic
1049554278 8:143274436-143274458 GTAAGCAGAGCCAAAACCTGGGG - Intronic
1049629730 8:143647098-143647120 GAAAGCAGAGGCAGGAGAGAGGG + Intronic
1050796788 9:9556338-9556360 GAAAGCAGAGGAAAAAGAGGTGG + Intronic
1052127579 9:24796847-24796869 CAAAGAAGAGGGAGAAGATGTGG + Intergenic
1052190325 9:25653973-25653995 GAAAGCAGAGCCTGAAGCAAGGG - Intergenic
1053190929 9:36067820-36067842 GAAAGCAGAGCAAGAATGTTTGG + Intronic
1054769085 9:69067787-69067809 GAAACCAGAAGCAGAAGCTGAGG - Intronic
1055009785 9:71552771-71552793 GGAAGCAAAGCTAGAAGACGGGG - Intergenic
1055346861 9:75349102-75349124 AAATTCAGAGCTAGAAGATGAGG - Intergenic
1055636735 9:78286587-78286609 GAAAGCAGAGCAATCAGATTGGG - Intergenic
1055638911 9:78304221-78304243 GAAAGCAGAGCCAGAAGATGGGG - Intronic
1055720541 9:79168200-79168222 GAAAGGAGAGCTAAAAGATGGGG + Intergenic
1056308928 9:85320568-85320590 GAAACCAGAAGCAGAAGCTGAGG - Intergenic
1056880876 9:90392659-90392681 GAATGCAGGGCCAGGAGAGGTGG + Intergenic
1056899254 9:90583271-90583293 GAAACCAGAACCAGAAGCTGAGG - Intergenic
1056943483 9:90974938-90974960 GAGAGCAGAGTGAGAAGAGGAGG + Intergenic
1057072660 9:92113709-92113731 AACAGCAGAGACAGCAGATGTGG - Intronic
1057244973 9:93447498-93447520 GAAACCAGAAGCAGAAGCTGAGG + Exonic
1057536994 9:95919916-95919938 CAAACCAGTGCCAGACGATGAGG + Intronic
1057962225 9:99467809-99467831 GAAAGAAGAGGAGGAAGATGGGG + Intergenic
1058290320 9:103233408-103233430 GAAAGCTGTGGCAGAATATGAGG - Intergenic
1059396420 9:114036736-114036758 GTGAGCAGAGACAGAAGGTGGGG + Intronic
1059516697 9:114902612-114902634 CTCAGCAGAGCCAGAATATGGGG - Intronic
1059610036 9:115882784-115882806 GAAACCAGAGGCTGAAGATGTGG + Intergenic
1059706223 9:116826034-116826056 GAAAGGTGAGCAAGAAGCTGTGG - Intronic
1059877060 9:118646752-118646774 GGAAGCAGAGCAAAAAGATTTGG + Intergenic
1060049240 9:120365601-120365623 GAAAGGAGAGAGAGAAGAGGGGG + Intergenic
1060717032 9:125941463-125941485 GAAAGCAGAGCTATCAGTTGGGG + Intronic
1060775063 9:126367088-126367110 GGTAGCAGAGACAGAAGAGGAGG - Intronic
1061038937 9:128128545-128128567 GAAAGCGGAGCGAGAAGAGTGGG - Intergenic
1061492639 9:130954536-130954558 GAAGGCAGAGGCTCAAGATGGGG - Intergenic
1061505689 9:131030685-131030707 GATACCAGAGCCAGGAGGTGCGG - Intronic
1061625482 9:131838565-131838587 GAGAGCAGAACCAGAGGCTGAGG - Intergenic
1061643705 9:131981682-131981704 CAGAGCAAAGCCAGGAGATGGGG + Intronic
1061651455 9:132053705-132053727 AGAAGCAGAGCAGGAAGATGGGG - Intronic
1062161264 9:135081463-135081485 GAAAGCAGGGCAAGAAGGAGGGG + Intronic
1185888750 X:3805729-3805751 AAAAGCAGAGAAAGAAAATGAGG + Intergenic
1187383512 X:18826911-18826933 CAAAGCAGAGGGAGAAGATACGG - Intronic
1187672319 X:21680521-21680543 CCCAGCAGAGCCAGAAAATGAGG + Intergenic
1187680967 X:21767602-21767624 GTAAGGAGAGCCAGAAGCTCTGG - Intergenic
1188520254 X:31030517-31030539 GAAAGCACAGTGTGAAGATGGGG - Intergenic
1189179104 X:38986739-38986761 GAAGGGAGAACCAGAACATGTGG - Intergenic
1190320661 X:49177527-49177549 GAAAGCTGGGCCTGAAGAGGAGG + Intronic
1190772278 X:53525363-53525385 GATGGCAGAGGCAGAAGAGGTGG - Intergenic
1192115214 X:68403967-68403989 GAATGCAGAGCCAGGAGACCTGG + Intronic
1192699679 X:73455317-73455339 GAATGGAGAGACAGAAGAGGGGG - Intergenic
1192961559 X:76136727-76136749 AAAAGAAGATCCAGAAGAGGAGG + Intergenic
1194548214 X:95264577-95264599 GAAAGCAGAAGTAGAAGAAGTGG - Intergenic
1194756676 X:97746531-97746553 GAAGCTAGAGGCAGAAGATGAGG - Intergenic
1195907265 X:109856763-109856785 GAAGGCAGAGAGAGAGGATGGGG + Intergenic
1196050462 X:111298538-111298560 GGAATAAGAGCCAGGAGATGTGG + Exonic
1196065440 X:111459101-111459123 GATGGCAGAGACAGAAGAGGCGG - Intergenic
1196095948 X:111800150-111800172 GGTAGCAGAGACAGAAGAGGTGG - Intronic
1196172237 X:112602320-112602342 GAAAGCAGAGCCTGAGGAAAAGG + Intergenic
1196386780 X:115163065-115163087 GAAAGCCTAGCCAAAAGATGAGG + Intronic
1197045807 X:121996872-121996894 AATAGCTGAGCCAGAATATGTGG + Intergenic
1197176004 X:123486309-123486331 TAAAGGAAAGCCAGAAGTTGTGG - Intronic
1198609188 X:138378815-138378837 GAGAGAAAAGGCAGAAGATGAGG + Intergenic
1198679810 X:139169609-139169631 GAAAGCAGGGCCAGACGCAGTGG - Intronic
1198991615 X:142520976-142520998 GAAAGCAGAGCCCCAAAATTTGG - Intergenic
1200124357 X:153806263-153806285 GGAAGCAGAGGCAGAGGCTGTGG + Intronic
1200773291 Y:7147182-7147204 AAAAGCAGAGAAAGAAAATGAGG - Intergenic
1200843689 Y:7809877-7809899 GAACTCAGAACCAGATGATGTGG - Intergenic