ID: 1055638912

View in Genome Browser
Species Human (GRCh38)
Location 9:78304222-78304244
Sequence AGAAAGCAGAGCCAGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654
Summary {0: 1, 1: 0, 2: 12, 3: 67, 4: 574}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055638912_1055638915 -3 Left 1055638912 9:78304222-78304244 CCCATCTTCTGGCTCTGCTTTCT 0: 1
1: 0
2: 12
3: 67
4: 574
Right 1055638915 9:78304242-78304264 TCTTATGTGTTCTCTTCATTGGG No data
1055638912_1055638914 -4 Left 1055638912 9:78304222-78304244 CCCATCTTCTGGCTCTGCTTTCT 0: 1
1: 0
2: 12
3: 67
4: 574
Right 1055638914 9:78304241-78304263 TTCTTATGTGTTCTCTTCATTGG No data
1055638912_1055638916 0 Left 1055638912 9:78304222-78304244 CCCATCTTCTGGCTCTGCTTTCT 0: 1
1: 0
2: 12
3: 67
4: 574
Right 1055638916 9:78304245-78304267 TATGTGTTCTCTTCATTGGGTGG No data
1055638912_1055638917 10 Left 1055638912 9:78304222-78304244 CCCATCTTCTGGCTCTGCTTTCT 0: 1
1: 0
2: 12
3: 67
4: 574
Right 1055638917 9:78304255-78304277 CTTCATTGGGTGGCCACCATTGG No data
1055638912_1055638918 17 Left 1055638912 9:78304222-78304244 CCCATCTTCTGGCTCTGCTTTCT 0: 1
1: 0
2: 12
3: 67
4: 574
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638912 Original CRISPR AGAAAGCAGAGCCAGAAGAT GGG (reversed) Intronic
900085951 1:897098-897120 GGAAAGCAGAGCCAGGAGATCGG - Intergenic
900894990 1:5477129-5477151 GGAAAGCAGAGCCTGAAGCAAGG - Intergenic
900984691 1:6066524-6066546 AGAAAACAGAGGCAGAAGGAAGG - Intronic
901931639 1:12599667-12599689 AAAGAGCAGAGCTAGAAAATAGG - Intronic
902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG + Intergenic
902122955 1:14183507-14183529 AGGAATCAAAGCCACAAGATCGG - Intergenic
902150614 1:14439986-14440008 AAAAAGTAGAGCCAGAACAGTGG - Intergenic
902851609 1:19162339-19162361 GGAAAACAGAGCCAAAAGCTTGG + Intronic
903144685 1:21363367-21363389 AGGAGGCAGAGCCAGGAGACTGG - Intergenic
903421095 1:23218068-23218090 AGAAAGCAGAGAAAGAAGGTAGG + Intergenic
903687897 1:25145990-25146012 GGAAGGCAGAGCCAGAAAGTGGG - Intergenic
903856181 1:26338631-26338653 AGAAGGCAAAGCCAGAGGAAGGG - Intronic
903951278 1:26997395-26997417 AGAAAGCAGAGCCAAATCAGAGG + Intronic
904312381 1:29637249-29637271 AGAAAGCAGAGAGATAAGATGGG - Intergenic
904358027 1:29954098-29954120 AGAAAGCAGAGGAGGAAGGTGGG + Intergenic
904402037 1:30263266-30263288 AGAAAGCAGAGAGAGAGGAAGGG + Intergenic
904859668 1:33526174-33526196 AGAAAGGAGTGACAGAAGAAGGG + Intronic
905778204 1:40684509-40684531 AGAAAACAAAGCCGGAAGAAGGG + Intergenic
906253655 1:44331046-44331068 AGAAAGCAAAGCCAGCAGGTTGG - Intronic
907196329 1:52689920-52689942 AGGAAGCTGAGGCAGAAGAATGG + Intronic
907590900 1:55670025-55670047 AGATGGCAGTGCCACAAGATGGG + Intergenic
908297760 1:62730272-62730294 AGAAAGAGGATCCAGAAAATAGG - Intergenic
908319284 1:62964750-62964772 AGAAAGCAGGGCCAGGCGAGAGG + Intergenic
908321988 1:62987385-62987407 AGAAAGGAGAGACACAAAATAGG - Intergenic
908888267 1:68814861-68814883 AGAAAGCAGGGAAAGAAGAAAGG + Intergenic
908973236 1:69863924-69863946 AGAAAGGAGAGATAGATGATAGG - Intronic
909078704 1:71083554-71083576 AGAAAGAAAAACCAGAAGAGGGG + Intergenic
909994498 1:82262364-82262386 AGAAAGATGAGGCAGAAGGTGGG - Intergenic
910943488 1:92562423-92562445 AGAAGGCTGAGGCAGAAGAATGG + Intronic
910983718 1:92983718-92983740 AAAAAGTGGAGCCTGAAGATGGG + Intergenic
911145183 1:94544916-94544938 AGAAACCAGATACAGAAGTTTGG + Intergenic
912897385 1:113606784-113606806 AGGAAGTAGAGCAAGAAGAGAGG - Intronic
913599091 1:120405736-120405758 AGAAAACAGAGCAAGAAGCTGGG - Intergenic
914088287 1:144473884-144473906 AGAAAACAGAGCAAGAAGCTGGG + Intergenic
914310324 1:146460326-146460348 AGAAAACAGAGCAAGAAGCTGGG - Intergenic
914379408 1:147102978-147103000 AAAAAACAGAGCAAGAAGCTGGG + Intergenic
914591785 1:149112816-149112838 AGAAAACAGAGCAAGAAGCTGGG + Intergenic
916191234 1:162180347-162180369 AGAAGGCTGAGGCAGAAGAACGG - Intronic
916781979 1:168043281-168043303 AGATAGCAAATCCAAAAGATGGG + Intronic
916827118 1:168453081-168453103 AGAAAGCAGAGCAAGCGGATGGG - Intergenic
917621942 1:176805300-176805322 AGAAAGCAGAGCCAAGAATTAGG - Intronic
918006719 1:180548116-180548138 AGAAGGCAGAGCCTGAAACTGGG - Intergenic
918111659 1:181460061-181460083 AGAAAGCAGAGCCTGAGGCAAGG - Intronic
918442709 1:184584011-184584033 ATAAAGCAGACCCAGCAGAGGGG - Intronic
919129494 1:193435619-193435641 AGAGAGTAGAGGCAAAAGATTGG + Intergenic
919652325 1:200162686-200162708 AGAAAGCAGAGGCAGCAACTCGG + Intronic
919657952 1:200215515-200215537 AGAAGTCAGAGGCAGAACATAGG - Intergenic
919729943 1:200907315-200907337 AGAAGGCAGAGCTAGGAGACAGG - Intronic
919742764 1:200990703-200990725 AGAAAGAAGTTCCAGAAGAAGGG - Exonic
920100286 1:203513124-203513146 AGAAAGGAGACCTAGAAGAGGGG + Intergenic
920597208 1:207284032-207284054 AGGAAGCTGAGCCAGAACTTTGG + Intergenic
923254985 1:232214082-232214104 AGAAAGCAGAGGCAGGAGCTGGG + Intergenic
924465136 1:244292690-244292712 GGGAGGCAGAGGCAGAAGATGGG + Intergenic
924612917 1:245588726-245588748 AGGAAGGAGACCCAGAGGATGGG - Intronic
1062988834 10:1796083-1796105 AGAGAGCAGAGGGAGAAGGTGGG + Intergenic
1064233143 10:13547641-13547663 AGAAGGCTGAGCCAGGAGAATGG + Intergenic
1064597521 10:16960908-16960930 AGAAGGCAGAGGCAGAATGTGGG + Intronic
1064809896 10:19184320-19184342 AGAGAGCAGAGCCAGTACCTAGG + Intronic
1065555258 10:26908733-26908755 TCAAAGCAGAGCCTGGAGATGGG - Intergenic
1065595594 10:27308073-27308095 TCAAAGCAGAGCCTGGAGATGGG + Intergenic
1066187708 10:33026499-33026521 GGAAATCAGAGCCAGGAGAGAGG - Intergenic
1066252906 10:33651676-33651698 AGAAGGCAGAGGCAGAAGTGTGG + Intergenic
1066254686 10:33667058-33667080 AGAAAGCAGAACCAGAGGATGGG + Intergenic
1066461107 10:35613073-35613095 ACACAGCAGAGCCAAAAGAAGGG + Intergenic
1067838903 10:49660335-49660357 AGAAAGCTGAGGCAGGAGAATGG + Intronic
1067979244 10:51064882-51064904 AGAAAGCAAAGCAAGAACAAGGG + Intronic
1068735030 10:60403768-60403790 AGAAAAGAGAGCCACAAGATTGG + Intronic
1069049958 10:63781900-63781922 GGAAAAGAGAACCAGAAGATGGG - Intergenic
1069140864 10:64823529-64823551 AGAAAGGAGAGAAAGAAGAAAGG + Intergenic
1069260643 10:66390902-66390924 GGAAAGAAGAGACAGAAGAAAGG - Intronic
1069270310 10:66518179-66518201 AAGAAGCAGATCCAGAATATCGG + Intronic
1069736549 10:70659586-70659608 TGGAAGAAGAGCCTGAAGATGGG + Intergenic
1070344956 10:75532496-75532518 AGAAAGCAGAGCCTGATGTTTGG - Intronic
1070546473 10:77456763-77456785 GGAAAGCTGACCAAGAAGATGGG + Intronic
1070653563 10:78255135-78255157 AGAAAACAGGTCCAGAGGATGGG + Intergenic
1070857153 10:79614902-79614924 AGAAAGCAGAGCCAGTGGTGTGG - Exonic
1072332358 10:94366064-94366086 AGCAAGTAGAGCAAGAAGAGTGG - Intergenic
1073597360 10:104814286-104814308 GGAAAGAAGAGCAGGAAGATCGG - Intronic
1073865909 10:107803458-107803480 AGAAAACAGCCCCAGAAAATAGG + Intergenic
1074361300 10:112825612-112825634 AGGAAAGGGAGCCAGAAGATGGG + Intergenic
1075776667 10:124993631-124993653 GGAAAGGAGAGGCAGAAAATTGG - Intronic
1075850057 10:125579552-125579574 CCAAATCAGAGCAAGAAGATGGG - Intronic
1076207314 10:128613432-128613454 AGAAAGCAGAACCAAGGGATGGG + Intergenic
1076707554 10:132309942-132309964 AGAAAGCTGACTCTGAAGATTGG + Intronic
1076728975 10:132429013-132429035 GGGAAGCAGAGCCAGAAGGCTGG + Intergenic
1077537239 11:3130304-3130326 AGGAAGCAGCCCCAGAAAATTGG - Intronic
1077792869 11:5460898-5460920 AGAAAACAAAGCCAGAGGCTTGG - Intronic
1077986488 11:7356442-7356464 AGAAAACAGAACCAGCAGAAGGG - Intronic
1078279496 11:9885894-9885916 AGAAAGTCATGCCAGAAGATTGG - Intronic
1078465635 11:11548003-11548025 AGAATTCAGAGTCAGAAGATAGG - Intronic
1078528102 11:12116079-12116101 AGGAGGCAGAGGCAGAAGAATGG - Intronic
1078610934 11:12818917-12818939 AGAAAGCAGACACAAAACATAGG + Intronic
1078822011 11:14891985-14892007 AGAAAGCAGAGCCAGGTGTACGG - Exonic
1079477091 11:20842271-20842293 AGGAGGCTGAGCCAGAAGAATGG + Intronic
1080087488 11:28302156-28302178 AGGAAGCTGAGCCAGGAGGTTGG - Intronic
1081307294 11:41529199-41529221 AAAAAGCAGAGCAAGAGAATTGG + Intergenic
1081977032 11:47242262-47242284 AGGAAGCAGAGCCAGATTCTAGG + Intronic
1082218237 11:49600852-49600874 GGAAAGCAGAGACAAAAGAAAGG + Intergenic
1082877285 11:58001186-58001208 AGAAAACAGAGGCTGAAGCTGGG + Intergenic
1083725031 11:64623445-64623467 GGGAAGCAGAGGGAGAAGATGGG - Intronic
1084511850 11:69610728-69610750 TGAAAGCAGAGCCCCAGGATGGG - Intergenic
1085618825 11:78022511-78022533 AGAAAGCAGATCCAGCAGCAGGG - Intronic
1085750767 11:79159123-79159145 AGAATGCAGAGCTATAAGAGGGG + Intronic
1086631333 11:89023265-89023287 GGAAAGCAGAGACAAAAGAAAGG - Intronic
1086760925 11:90629922-90629944 AAAAAGAAGAGCAATAAGATGGG + Intergenic
1086774543 11:90814102-90814124 AGAAGGTATAGGCAGAAGATTGG + Intergenic
1086831042 11:91563913-91563935 AGAGATCAGAACCAGAAGCTGGG + Intergenic
1086878199 11:92123373-92123395 AGAAAGTAGATGTAGAAGATAGG - Intergenic
1089527455 11:119106868-119106890 AGAAAGCAGAACCTGAAGCTGGG - Intronic
1091125346 11:133090768-133090790 AGAAAGCAGAACTTAAAGATTGG + Intronic
1092709829 12:11324318-11324340 AGGAAGCAGAGGCAGGAGAATGG - Intergenic
1092796512 12:12115226-12115248 AGAAAGAAAAGGCAGAAGATTGG - Intronic
1093854373 12:24082188-24082210 ACAAAGCAGAGACAAATGATGGG + Intergenic
1093900864 12:24630557-24630579 AGAAATCAGTCCCAGGAGATGGG - Intergenic
1094160579 12:27385740-27385762 TGAAAGTAGAGACAGAGGATAGG + Intronic
1094349767 12:29511134-29511156 AGAAAAAAGAGAAAGAAGATTGG - Intronic
1095280840 12:40351042-40351064 AGAAAACAGAACCAGAAGTCAGG - Intronic
1095310303 12:40690928-40690950 AGAAAGCTGAGGCAGGAGAATGG - Intergenic
1095840040 12:46682981-46683003 AGTAGGCAGAGCCAGAGGTTGGG - Intergenic
1096117137 12:49061088-49061110 TGGAAGAAGAGCCAGGAGATTGG + Intergenic
1096586919 12:52628904-52628926 AGAGAGCAGGGCCAGAAGATTGG + Intergenic
1096600709 12:52726691-52726713 AGAAACCAGAGCCAGTGGTTGGG - Intergenic
1096679567 12:53246507-53246529 AGGAAGCTGAGCCAGGAGAATGG + Intergenic
1096741477 12:53696904-53696926 AGGAAGCTGAGCCAGAAGGGAGG - Intergenic
1098016367 12:66108774-66108796 GGAAAGTAGAGCCAAAGGATTGG - Intergenic
1098167324 12:67711690-67711712 ATAAAGCTCAGGCAGAAGATGGG + Intergenic
1098419379 12:70276884-70276906 TAAAAGAGGAGCCAGAAGATAGG + Intronic
1098450220 12:70610444-70610466 AGAAAGCAGATGAGGAAGATAGG - Intronic
1098544508 12:71696749-71696771 AGGAAGCTGAGCCAGGAGAATGG - Intronic
1098720465 12:73891272-73891294 TGAAAGAAAAGCCAGATGATAGG - Intergenic
1098819249 12:75208268-75208290 AGAGATCAGAGCCAAAAGAAAGG - Intronic
1100067699 12:90670036-90670058 ATAAAGCACAGCCAGAAGTAAGG - Intergenic
1100154888 12:91786584-91786606 AGAAAACAAAGCCAGAAGACTGG + Intergenic
1101075034 12:101120104-101120126 ACAAAGCAGAGACAGCAGAGAGG - Intronic
1101092605 12:101303359-101303381 ACAAAGCAGGGTCAGGAGATAGG + Intronic
1101638811 12:106570351-106570373 AGAAAGCAGAGCTTGAATGTGGG + Intronic
1102172108 12:110850162-110850184 AGGAGGCAGAGCCACAAGACAGG - Intronic
1102310315 12:111839861-111839883 AGAAGGCAAGGCCTGAAGATGGG - Intergenic
1102313217 12:111863709-111863731 AGGAAGCTGAGGCAGAAGAGTGG - Intronic
1102529687 12:113537000-113537022 ACAAAAGAGAGCCAGAAGAGTGG + Intergenic
1102783636 12:115586017-115586039 AGAAGGCAGAGCCAAGAGAGGGG + Intergenic
1103957923 12:124588992-124589014 AGTAAGTAAAGCCTGAAGATGGG - Intergenic
1104145892 12:126033403-126033425 AAAAGGCAGATCTAGAAGATGGG - Intergenic
1106443473 13:29801503-29801525 AGCAAGCAGAGCCCCAAGCTTGG + Intronic
1106444292 13:29811156-29811178 GGAAAGCAGAGCAAGTAGACAGG + Intronic
1106879047 13:34109296-34109318 AAAAAGCAGGGCCAGGAGACAGG + Intergenic
1107035822 13:35901579-35901601 AGAAGACAGAGCCAGAGGTTTGG + Intronic
1108180722 13:47837309-47837331 AAAAAGCAGAGCCATAAGTAAGG - Intergenic
1108458845 13:50644761-50644783 AGAAAGCACAGCCGGAAGGCAGG - Intronic
1108768963 13:53673122-53673144 GGACAGCAGAGCTAGAAAATGGG + Intergenic
1109273967 13:60283804-60283826 AGAAGGCACAGACAGGAGATTGG - Intergenic
1109476234 13:62882974-62882996 AGAAAGCAGAGCTAAAGGTTTGG - Intergenic
1109783780 13:67147979-67148001 ATAAAGCAGACCCAGAAAGTCGG + Intronic
1111305365 13:86406159-86406181 AGAAAGCTGAGACAGGAGAATGG - Intergenic
1111877591 13:93916249-93916271 AGGAAGCAGAGCCTGAAGCATGG - Intronic
1111967428 13:94875212-94875234 AGGAAGCTGAGGCAGAAGAACGG - Intergenic
1112199524 13:97261504-97261526 GGAAAGCAGAGGCAGAAAAAGGG - Intronic
1112386768 13:98946913-98946935 GGGAAGCAGAGACAGAAGTTAGG - Intronic
1112501029 13:99943304-99943326 AGGAAGCTGAGGCAGGAGATTGG + Intergenic
1112542047 13:100323634-100323656 AGAAAACAGAACTAGAAGTTAGG + Intronic
1113045843 13:106153628-106153650 AGCAAGCAGTGCCAAGAGATGGG + Intergenic
1113570392 13:111350110-111350132 AGAAGGCTGAGGCAGAAGAATGG - Intergenic
1114258677 14:21022764-21022786 AGAAAGCAAAGAGAGAAGAGAGG + Intronic
1114286375 14:21247896-21247918 AGAAAGAATCGCCAGAACATGGG + Intronic
1114730840 14:24990942-24990964 AGAGAGCAGAGAGAGAAGAAAGG + Intronic
1115172599 14:30526159-30526181 AGAAAGCAGACCCCAAAAATGGG + Intergenic
1115365414 14:32551761-32551783 AGAAGGCAGAGGCAGGAGAATGG - Intronic
1115789722 14:36865373-36865395 AGAAATCAGCACCAGAGGATGGG - Intronic
1116369288 14:44109436-44109458 AGGAAGCAGAGCCTAAAAATTGG + Intergenic
1118136215 14:63031037-63031059 AGAAAGGAAAAGCAGAAGATGGG - Intronic
1118406906 14:65433771-65433793 AGAGAGAAGAGACAGAAGAGAGG - Intronic
1119009647 14:70971639-70971661 AGTAAGTAGAGACAGAAGATAGG + Intronic
1119729957 14:76944961-76944983 AGTAAGCAGATACAGCAGATAGG - Intergenic
1119942971 14:78660640-78660662 GAAAATCAGAGCCAAAAGATGGG + Intronic
1120281540 14:82444632-82444654 TGAATGCAAATCCAGAAGATTGG + Intergenic
1120369891 14:83619843-83619865 AGGAAGCTGAGGCAGAAGAATGG + Intergenic
1120584531 14:86295425-86295447 GGAAAGCTGAGCAAGAAGACAGG - Intergenic
1121171890 14:91861546-91861568 AGAAAGAAGAGAGAGAAGAGAGG + Intronic
1121621427 14:95352050-95352072 AGAAAGCAGAGAGAGAGGAATGG - Intergenic
1122101425 14:99413288-99413310 AAGAAGCAGAGCCAGAAGGACGG + Intronic
1122473919 14:101992588-101992610 TGAAAGAAGACCCAGAAGAGAGG - Intronic
1123388903 15:19848961-19848983 AGAAAGCTGAGGCAGGAGAATGG + Intergenic
1123498122 15:20851214-20851236 ATAAAGCAGAGGCAGAAGAGAGG - Intronic
1123555353 15:21424842-21424864 ATAAAGCAGAGGCAGAAGAGAGG - Intronic
1123591596 15:21862173-21862195 ATAAAGCAGAGGCAGAAGAGAGG - Intergenic
1124236217 15:27991464-27991486 AGAAGCCAGACACAGAAGATGGG + Intronic
1124492567 15:30167225-30167247 GGACAGCAGAGCCAGGTGATAGG - Intergenic
1124750967 15:32371100-32371122 GGACAGCAGAGCCAGGTGATAGG + Intergenic
1125229596 15:37438124-37438146 AGGAAGCTGAGGCAGAAGAATGG - Intergenic
1126197161 15:45944900-45944922 AGAAAGAAGCCCCAGAGGATGGG + Intergenic
1126206909 15:46056447-46056469 AGAAAGCAGGGCGGGAAGGTTGG - Intergenic
1126364958 15:47884676-47884698 CAAAAGCTGAGCCAGAAGAAAGG + Intergenic
1126715114 15:51507617-51507639 AGAAAGCAGCAGCAGAAGAATGG + Intronic
1126767993 15:52028055-52028077 GGAAAGCTGAGGCAGAAGAATGG - Intronic
1127344847 15:58084053-58084075 AGAAAGAAAAGGAAGAAGATTGG + Intronic
1127654176 15:61040291-61040313 AAAAAGCAAAGCAAGAATATGGG + Intronic
1128094628 15:64944305-64944327 AGAAATCAGAGCCCAGAGATGGG - Intronic
1128955685 15:71940936-71940958 AGAAAGAAGAGACAGAAGAAAGG + Intronic
1128994536 15:72287101-72287123 AGAGAGAAGAGCCAGGAGCTAGG - Intronic
1129386396 15:75198455-75198477 AGCAAGCAGAGCCTGAAGCTGGG - Intronic
1129388932 15:75210893-75210915 AGAAAGCAGAGGCAGCTGCTGGG + Exonic
1129515588 15:76155173-76155195 TGAAGGCAGAGCCAGAAGTGTGG + Intronic
1129516671 15:76161446-76161468 AGAGAGCAGAGCCATTAGCTAGG - Intronic
1129978944 15:79848589-79848611 AGAAAGAAAAGGCAGAAGTTTGG + Intronic
1130025667 15:80268607-80268629 TCAACGCAGAGGCAGAAGATGGG + Intergenic
1132426236 15:101719762-101719784 AGACAGCAGATCAACAAGATGGG + Intronic
1202963699 15_KI270727v1_random:152052-152074 ATAAAGCAGAGGCAGAAGAGAGG - Intergenic
1133085873 16:3362955-3362977 AGAAAGCAGAGCCTGAGTGTGGG - Intergenic
1133677831 16:8092193-8092215 AGAAAGCAGCATCAGGAGATGGG + Intergenic
1133734726 16:8606414-8606436 AGCAAGCAGAGCTAATAGATTGG - Intergenic
1133739546 16:8640852-8640874 AGAAGGAAGGGCCGGAAGATGGG + Intronic
1134305824 16:13031189-13031211 GGAAGGCAGAGGCAGAAGAGGGG - Intronic
1134659082 16:15970223-15970245 GGACAGCAGAGCAACAAGATGGG - Intronic
1134820348 16:17241767-17241789 AGAAGACAGTTCCAGAAGATAGG - Intronic
1135073569 16:19373635-19373657 AGAAAGGAGAGGCAGAAAAGTGG + Intergenic
1135503250 16:23015138-23015160 AGAAAGCAGAGCCAGAAGCAAGG + Intergenic
1136078185 16:27831240-27831262 AGAAAGCAGAGCCATGAAAAGGG + Intronic
1136577197 16:31131839-31131861 AAAAAGCACACCCAGAAGAATGG + Exonic
1137866670 16:51904421-51904443 GGAAAGCAGAACCAAGAGATGGG + Intergenic
1137882594 16:52067487-52067509 AGAAAGCAGAACCATCAGTTAGG - Intronic
1137974007 16:53015054-53015076 TGAAAGCAGAGCCAGAAACATGG + Intergenic
1139130420 16:64135892-64135914 AAAGAGCAGATCAAGAAGATGGG - Intergenic
1139562645 16:67753501-67753523 AAAATGCAAAGCCAGATGATGGG + Intronic
1139591681 16:67936505-67936527 TGAAAGCAGAGCCGAAACATGGG - Intronic
1139666534 16:68460771-68460793 AGAGAACTGAGCCAGAAGAATGG - Intergenic
1139804806 16:69555571-69555593 AGGAAGAAGAGCCAAGAGATGGG - Intergenic
1140615880 16:76663136-76663158 AGAAGTCGGAGCCAGAAGATGGG + Intergenic
1141571972 16:84939778-84939800 AGAAACCAGAGCCAGAAAATAGG + Intergenic
1143180323 17:4980433-4980455 AGGAAGAAGAGGAAGAAGATGGG + Exonic
1143433138 17:6901714-6901736 AGCAAGGAGAGTCAGAAGAGAGG + Intronic
1144031210 17:11325014-11325036 AGAAATTGGAGCCAGAAGCTAGG - Intronic
1144316206 17:14064031-14064053 AGACAGCAGAGCAATAAAATAGG - Intergenic
1144383703 17:14728710-14728732 AGAAAGAGGAGCCTGGAGATGGG + Intergenic
1144395479 17:14838834-14838856 AGAAGGCCCAGACAGAAGATAGG + Intergenic
1145105186 17:20109555-20109577 AGAAAGCAAAGCCAGAACAGAGG + Intronic
1146071343 17:29684783-29684805 AGGCAGCAGAGCCAGTAGTTAGG + Intronic
1146305087 17:31724521-31724543 AGAGACCAGAGCCCCAAGATGGG - Intergenic
1147051989 17:37802176-37802198 AGAAGGCAGAGCAAGGAGAGGGG - Intergenic
1147125058 17:38361678-38361700 AGAAAGCAGAGAGAGAATAGAGG - Intronic
1147372453 17:40002442-40002464 AAAAAGTGGAGCCTGAAGATGGG + Intergenic
1147410768 17:40250333-40250355 AGAAGGCTGAGGCAGAAGAATGG - Intronic
1147444911 17:40469161-40469183 AGAGAACAGGGCCAGAAGACAGG - Intergenic
1148020194 17:44548268-44548290 AAAGAGCAGAGTGAGAAGATGGG + Intergenic
1148161856 17:45454663-45454685 AGAAAGCAGTGACAGAGGAGAGG - Intronic
1148166879 17:45490206-45490228 AGAAAGCTGAGCCAGAAAAGGGG + Intronic
1148904409 17:50902862-50902884 AGAAAGTACAGGCAGAAGAAAGG - Intergenic
1149290301 17:55211913-55211935 AGAAAGCAGAGGCAGGAGAATGG - Intergenic
1150398056 17:64836610-64836632 AGAAAGCTGAGCCAGAAAAGGGG + Intergenic
1150435644 17:65152214-65152236 AGAGGGAAGAGCCAGAACATGGG + Intronic
1150735131 17:67730363-67730385 GGAAAGCTGAGACAGAAGAATGG - Intronic
1150887814 17:69108140-69108162 AGAGAGAAGACCCAGAATATAGG - Intronic
1150962626 17:69931218-69931240 AGAAAGCAGAAACAGATGAGCGG + Intergenic
1151199693 17:72458611-72458633 AGATAGGAGAGGCAGAAGAAAGG - Intergenic
1151400659 17:73853784-73853806 AGAAATCATACCCAGGAGATGGG - Intergenic
1151539876 17:74759438-74759460 AGAGACCAGGGCCAGAGGATGGG + Intronic
1152037074 17:77880136-77880158 TGAAAGCAGAGGCAGGAGGTGGG + Intergenic
1152438758 17:80292397-80292419 AGAAAACGAAGCCAGAAGAAGGG + Intronic
1152472788 17:80499733-80499755 AGAAAGCAGTGCCCGAAGCTGGG + Intergenic
1152664791 17:81561290-81561312 AGAAAGCAGAAGAAGAAGCTGGG - Intronic
1153810731 18:8749595-8749617 AGAAAGCAGAGCCTGAGCTTGGG + Intronic
1153990002 18:10388174-10388196 AGAAAGCAGAGCCAGAGTCAAGG + Intergenic
1154456123 18:14527638-14527660 ATAAAGCAGAGGAAGAAGAGAGG - Intronic
1155171464 18:23269893-23269915 AGGAAGCAGAGCAAAAAGTTTGG + Intronic
1155351563 18:24912500-24912522 ATAAAGGAGAGACAGAACATTGG + Intergenic
1155373795 18:25134501-25134523 AGAAGGCAGAGTAAGCAGATGGG - Intronic
1156669322 18:39448574-39448596 AGAAAGAAGACCCACAATATTGG + Intergenic
1156958777 18:42997448-42997470 AGAAAGAAGAGAGAGAAGAAGGG + Intronic
1157450444 18:47782774-47782796 AGAAGGCATAAACAGAAGATAGG - Intergenic
1157633177 18:49120972-49120994 AGAAAACAGAGGCAGAGGCTGGG - Intronic
1158310948 18:56157700-56157722 AGAAAGTGGAGCCAAAAGAAGGG - Intergenic
1158905980 18:62012294-62012316 AGAAAGGAGAGCCAGTCTATGGG - Intergenic
1159423606 18:68254594-68254616 AGAAAGCGTAGGCAGAAGAAGGG + Intergenic
1159798602 18:72869742-72869764 AGAAAGGAGAGAGAGAAGAAAGG + Intergenic
1159884026 18:73887155-73887177 AGAAATCAGAACCACATGATAGG - Intergenic
1160055620 18:75477084-75477106 AGAAAGCAGCCCAAGAAGACAGG - Intergenic
1160611984 18:80095994-80096016 TGGAAGCAGAGCTAGAAAATAGG - Exonic
1163605776 19:18274527-18274549 AGAAGGCACAGCCAGAGGTTGGG + Intergenic
1164972902 19:32547735-32547757 AGAGAGCAGAGCCAGGAGGTGGG - Intergenic
1165613004 19:37173167-37173189 AGAAACCACAGGCAGATGATAGG + Intronic
1165616827 19:37209455-37209477 ATAAAGCAGAAACAGAAGAAAGG + Intronic
1166398286 19:42458628-42458650 AGAAAGGAGACCAAGAAGATGGG + Intergenic
1166533087 19:43554045-43554067 TGGATGCAGAGCCAGAAAATAGG + Intronic
1166729649 19:45051861-45051883 AGAAAGCTGAGGCAGGAGAATGG + Intronic
1166749345 19:45157368-45157390 ATAAAGCAGGGACAGGAGATGGG - Intronic
1166852924 19:45768942-45768964 AGAAAGAAGATCGAGAAGAGCGG - Exonic
1167406543 19:49312694-49312716 CAAAAGCAGAGGCAGTAGATGGG + Intronic
1167844201 19:52147223-52147245 AGAAAGCAGAGAGAGAACTTGGG - Intergenic
1167859847 19:52273790-52273812 GTAGAGCAGAGCCAGAAGGTGGG + Intronic
1167880869 19:52456266-52456288 GGAGACCAGAGCCAGAAGATAGG + Intronic
1167906048 19:52661676-52661698 GGAGAGCAGAGCCAGAAGGTGGG - Intronic
1167912626 19:52716471-52716493 GGAGGGCAGAGCCAGAACATGGG - Intronic
1167921897 19:52788956-52788978 GGAGAGCAGAGCCAGAAGGTGGG - Intronic
1167932135 19:52874610-52874632 GGAGAGCAGAGCCAGAAGGTGGG - Intronic
1167945059 19:52981517-52981539 GGAGAGCAGAGCCAGAAGGTGGG - Intergenic
1167958444 19:53086888-53086910 GGAGAGCAGAGCCAGAAGGTGGG - Intronic
1167970019 19:53183521-53183543 GGAAAGTACAGCCAGAAGGTGGG - Intronic
1168666828 19:58210686-58210708 AGAAAGCAGAGCCATGAAACAGG - Intronic
925039541 2:720602-720624 AGTGGGCAGAGCCAGATGATAGG + Intergenic
926970748 2:18464635-18464657 AGAAAGCTGAGGCAGAAGGATGG + Intergenic
927105680 2:19821697-19821719 AGGAAGCTGAGGCAGAAGAATGG + Intergenic
927303387 2:21541586-21541608 AGAAAGCAGAGCCATACTGTTGG - Intergenic
927396033 2:22652363-22652385 TCCAAGCAGAGCCAGAAGAAAGG + Intergenic
927631831 2:24781152-24781174 AGAAGGCAGATGCAGAAGCTAGG + Intergenic
927996730 2:27492273-27492295 TGTGAGCAGAGCCAGAAGGTAGG - Exonic
928486688 2:31739387-31739409 AGAAAACAGAGCCTGAAAATTGG - Intergenic
928725152 2:34163993-34164015 AGGAAGCTGAGGCAGAAGAATGG - Intergenic
929123363 2:38501481-38501503 AGAAAGCAGGGTCACAAGAGAGG + Intergenic
929371035 2:41223807-41223829 AGAAATCAGCTGCAGAAGATGGG + Intergenic
929722269 2:44382581-44382603 AGGAAGCTGAGGCAGAAGATCGG - Intronic
932805735 2:74781193-74781215 AGAGAGAAGAGCCTGAAAATTGG - Intergenic
933000844 2:76920858-76920880 AGAAAACAGAGACAGACGCTAGG - Intronic
933185891 2:79278898-79278920 GGAAAGGAGAACAAGAAGATGGG + Intronic
933785112 2:85832913-85832935 AGGAGGCTGAGCCAGAAGAATGG + Intergenic
934748376 2:96774989-96775011 AAAAAAAAAAGCCAGAAGATTGG + Intronic
934798600 2:97127951-97127973 ATAAAGCAGAAGCAGAAAATAGG + Intronic
934874033 2:97897247-97897269 AGAAATAAGAGCCATCAGATTGG - Intronic
934888940 2:98048698-98048720 AGAAAGAGAACCCAGAAGATTGG + Intergenic
934980518 2:98836050-98836072 AGAAAGCAAAGCCAGAATATGGG + Intronic
935315202 2:101826509-101826531 AGAAAGCAGAGCCTAAATGTGGG + Intronic
935887536 2:107638412-107638434 AGAAAGCAGAGCCTCAAGATGGG - Intergenic
936534234 2:113299326-113299348 AGAAAGCAGAGCCTGAGGCAAGG - Intergenic
936866289 2:117078865-117078887 AGAAGGGACAGCCAGGAGATGGG - Intergenic
937151380 2:119688750-119688772 AGAATGCAGGGCCAGAAGCAGGG - Intergenic
937158648 2:119739960-119739982 AGCAGGCAGGGCCAGAAGCTGGG + Intergenic
937673498 2:124563989-124564011 AGAAAACAGAACCTGAATATTGG + Intronic
937717478 2:125050066-125050088 AGAAAAATGAGCAAGAAGATTGG - Intergenic
938283832 2:130090598-130090620 ATAAAACAGAGGCAGAAGAGAGG - Intronic
938284984 2:130105149-130105171 ATAAAGCAGAGGCAGAAGAGAGG - Intronic
938334479 2:130479162-130479184 ATAAAACAGAGGCAGAAGAGAGG - Intronic
938335628 2:130493696-130493718 ATAAAGCAGAGGCAGAAGAGAGG - Intronic
938354195 2:130626967-130626989 ATAAAGCAGAGGCAGAAGAGAGG + Intronic
938355346 2:130641506-130641528 ATAAAACAGAGGCAGAAGAGAGG + Intronic
938430620 2:131233742-131233764 ATAAAGCAGAGGCAGAAGAGCGG + Intronic
938431776 2:131248295-131248317 ATAAAACAGAGGCAGAAGAGAGG + Intronic
938576604 2:132609964-132609986 ACCAAGCAGAGACAGAAGTTGGG - Intronic
939082047 2:137674143-137674165 AGAATGCAAAGCCAGGAGAACGG - Intronic
939357687 2:141125436-141125458 AGAATGCAGAGAAAGAAGATAGG + Intronic
939773003 2:146347490-146347512 AAAGAGCAGAGCCAGAGGCTGGG + Intergenic
940907587 2:159183187-159183209 AGGAAGAAGAGCCAGAAACTAGG + Intronic
941169634 2:162120842-162120864 AGGAAGCAAAGCCATAAGCTGGG + Intergenic
941295591 2:163735483-163735505 AGAAAGCGGAGCCATAGGGTGGG - Intronic
942229010 2:173842253-173842275 AGAAAGGAAAGAGAGAAGATGGG + Intergenic
943493488 2:188585921-188585943 AGGAAGCAGAGCAAAAAGTTTGG - Intronic
943761689 2:191616991-191617013 AGTAAGTAGAGCCAGACAATGGG + Intergenic
943997886 2:194795432-194795454 AGAAAGCAGAGACAGAATTAGGG - Intergenic
944081870 2:195797279-195797301 AGAAAGGAGACCCAGAAGCCAGG - Intronic
944915949 2:204360354-204360376 AGAAGGCAGGACCAGAAGGTAGG + Intergenic
944943153 2:204652222-204652244 AGGAAGCAGAGCAAGAAGTTCGG - Intronic
945268886 2:207918970-207918992 AGTAAGCAGAGAAAGAAGACAGG + Intronic
945566874 2:211412045-211412067 AGACAACAGAAACAGAAGATAGG + Intronic
946320371 2:218950587-218950609 GGAAAGCAGAGTCAACAGATGGG - Intergenic
946833669 2:223750275-223750297 AGAAGGCAGAGCCATGAGATGGG - Intergenic
946929263 2:224656009-224656031 AGAAGGCTGAGACAGAAGAATGG - Intergenic
946959495 2:224968944-224968966 ACCAAACAGAGGCAGAAGATTGG + Intronic
946994123 2:225371585-225371607 AGATAGCAGATGCAAAAGATTGG + Intergenic
947497253 2:230646889-230646911 AGGAAGCAGAGCTAGAAGCCGGG - Intergenic
1169990538 20:11498231-11498253 AGAAAGCAAAGAAAGAAGACAGG + Intergenic
1170179502 20:13513427-13513449 AGAAGGCAGAGCAAGAAGTGGGG + Intronic
1170329518 20:15193126-15193148 AGAGAGAAGAGAAAGAAGATGGG - Intronic
1170816354 20:19717710-19717732 AGAAGAAAGAGCCAGGAGATGGG - Intronic
1171127108 20:22611937-22611959 CCAATGCAGAGACAGAAGATGGG - Intergenic
1171247387 20:23622844-23622866 AGAAAGGAGAGGGAGCAGATGGG - Intergenic
1171887250 20:30665527-30665549 ATAAATCAGAGCCAGATGAAAGG - Intergenic
1172328212 20:34054028-34054050 AGAAGGCAGAGTGAGAAGCTGGG - Intronic
1172487838 20:35309559-35309581 AGAAAGCAGAACTGGAAGAAGGG + Intronic
1173146014 20:40524936-40524958 AGAAAGCAGGGAGATAAGATTGG - Intergenic
1173339141 20:42138260-42138282 GGAAAGCACAGGCAGAAGATTGG + Intronic
1173439603 20:43064293-43064315 GGAAGACAGAGCCACAAGATGGG + Intronic
1173544630 20:43885509-43885531 AGAAAGCAGAGCTCAAAGCTTGG + Intergenic
1174068322 20:47881968-47881990 AGAGATCAGAGACAGAAGTTAGG + Intergenic
1174537543 20:51263657-51263679 AGAACCCAGAGCAAGAAGAGAGG - Intergenic
1174769035 20:53281159-53281181 AGAATGCTGAGCCAAAAAATGGG + Intronic
1175352752 20:58337002-58337024 AGAAAGTTGAGGGAGAAGATGGG - Intronic
1175477141 20:59284765-59284787 AGAAAGAAGATCCAGAAAAGGGG - Intergenic
1175739796 20:61412649-61412671 AGAAGGCAGAGCTGGAAGGTGGG - Intronic
1175767794 20:61603293-61603315 AGAAAACAAAGCCAGGTGATGGG + Intronic
1176228146 20:64015390-64015412 AGAAAGCAGAGCCAAGAGCAAGG - Intronic
1176818040 21:13625698-13625720 ATAAAGCAGAGGAAGAAGAGAGG + Intronic
1177032578 21:16000118-16000140 AGAAAGAACAGGCAGAAAATGGG + Intergenic
1177216809 21:18140628-18140650 AAAAAATAGAGCCAGAAAATGGG + Intronic
1177732920 21:25052085-25052107 AGAAAGCTGAGGCAGGAGAATGG + Intergenic
1178303207 21:31469725-31469747 AGAAGGCTGAGGCAGAAGAATGG + Intronic
1178316663 21:31572183-31572205 AGGAAGCAAAGACAGTAGATCGG - Intergenic
1178634912 21:34293856-34293878 AGAAAGTAGTTCCAGAAGAAGGG - Intergenic
1178919973 21:36732353-36732375 AGAAGGCAGAGCAAGAACAGAGG - Intronic
1179018307 21:37614288-37614310 AGAAATCAAAGCCTTAAGATTGG - Exonic
1180975894 22:19848260-19848282 AGAAAGCAGAGCCAGCACCATGG + Exonic
1181112946 22:20612518-20612540 AGTAGGCAGAACCAGCAGATAGG + Intergenic
1181296410 22:21843343-21843365 AGACATCAGAGGCAGAAGAAGGG + Intronic
1181528854 22:23504700-23504722 AGAGAGGAGAGGCAGAAGCTGGG + Intergenic
1181616126 22:24055507-24055529 AGAGAGCAGGACCAGAAGAGGGG - Intronic
1182010786 22:26999131-26999153 AGGAGGCTGAGCCAGAAGAATGG - Intergenic
1183592695 22:38789702-38789724 AGAAAGTAGTGCCACAAGACAGG + Intronic
1184066697 22:42125545-42125567 AGAAGGCAGAGCAGGAAGACAGG + Intergenic
1184069165 22:42137697-42137719 AGAAGGCAGAGCAGGAAGACAGG + Intergenic
1184145133 22:42605671-42605693 AGAAAGCAGGGCCAAAGGAAGGG + Intronic
1184267769 22:43358912-43358934 AAAAAGCACAGCCTGAAGCTTGG + Intergenic
949767504 3:7543382-7543404 AGAAAGCAAAGATATAAGATGGG + Intronic
951108947 3:18778267-18778289 AGAAAGAAGAGGGAGAAGAAAGG + Intergenic
953933643 3:47020807-47020829 AAGAAGCAGAACCAGGAGATGGG - Intronic
954001684 3:47562581-47562603 CTAAAGCAGAGCAAGAAGAGAGG - Exonic
954516101 3:51178558-51178580 AGAAAGCAGAGCCAGAGCTGGGG + Intronic
954638607 3:52085049-52085071 AGAAAGGAGAGGCAGCAGCTGGG + Intronic
955220699 3:57020683-57020705 AGAAAGCAGAGCCAAGAGAAGGG + Intronic
955537242 3:59936940-59936962 AGAAAGTAGAACCAGAAATTTGG + Intronic
955710216 3:61770982-61771004 GGAAACAAGAGCCAGAAGAAAGG - Intronic
956354599 3:68377511-68377533 AGGAAGCAGAGCTAAAAGTTTGG + Intronic
956365692 3:68500040-68500062 AGAAGGCACAACCAAAAGATGGG - Intronic
956642474 3:71428058-71428080 TGATAGCAGTGCCTGAAGATGGG - Intronic
957769851 3:84676471-84676493 AGAAAGCAGAGAAAGGAGATTGG + Intergenic
957782375 3:84835688-84835710 ACAAAGCAAAACCAGAAGACTGG + Intergenic
957813266 3:85256095-85256117 AGAAAACAGAGTCAGGAAATGGG - Intronic
958702166 3:97606371-97606393 AGAAAGCAAAGGCAGAATATGGG + Intronic
959733281 3:109628572-109628594 AGGAAGCCCAGGCAGAAGATGGG - Intergenic
959930802 3:111979651-111979673 AGAAAGCAGAACTAGAAATTAGG - Intronic
960291359 3:115889155-115889177 GGAAAGGTGAGCCTGAAGATGGG + Intronic
960684393 3:120282575-120282597 ATAAAGCAGGGTCAGAAGACAGG + Intronic
960965895 3:123104492-123104514 AAAAACCACAGCCAGAACATGGG - Intronic
963051075 3:141144489-141144511 AGAAAGAAGAGCCAAGAGAATGG + Intronic
963247018 3:143072981-143073003 GGGAAGCAGAGCCAAAAAATGGG + Intergenic
963380306 3:144521642-144521664 AGAAAGCAGGGAAAGGAGATAGG + Intergenic
963477771 3:145829001-145829023 AGCAAGAGGAGCCAGAAGAGAGG + Intergenic
963735584 3:149014761-149014783 AGAAGGCTGAGGCAGAAGAATGG + Intronic
964159309 3:153627486-153627508 AGAAAGCAGAGCCACTAAAGGGG + Intergenic
964344048 3:155738296-155738318 AGAAAGAAGACCCAGAAGAAGGG + Intronic
964580337 3:158227359-158227381 AGAAAGCAAAGGAAGAAAATCGG - Intronic
965625164 3:170677615-170677637 AGAAGGGAGAGACAGAAGAGTGG + Intronic
965942491 3:174201495-174201517 AGAAGGCAGAGCTGGAAGGTGGG - Intronic
966438319 3:179914926-179914948 AGAAAGGAAAGAAAGAAGATTGG + Intronic
966541524 3:181096333-181096355 GGGAAGCAGAGCAAGATGATAGG - Intergenic
966976555 3:185088967-185088989 AGCCAGCAGAGCCTGAAGAGGGG + Intronic
967109365 3:186280025-186280047 AGACAGCAGAGGCAGAAGGCAGG - Intronic
967965503 3:194957105-194957127 AGATAGCAGAGCCAGAATCCAGG + Intergenic
968615349 4:1575233-1575255 AGAAAGCGCAGCCACAGGATGGG + Intergenic
968944227 4:3655139-3655161 AGACACCAGAGCCAGCAGAAGGG - Intergenic
968955241 4:3715738-3715760 AGAAAGCAGAGCCTGAGGCATGG + Intergenic
969431705 4:7158950-7158972 AGAAAGCAGAGTCTGAGGCTGGG + Intergenic
969456821 4:7305016-7305038 AAAAAGAAGAGCCAGAATGTCGG - Intronic
970083905 4:12323465-12323487 AGAAAGGGTAGCCAGAGGATTGG - Intergenic
970462918 4:16293545-16293567 GGACAGCAGAGCTAGAAGCTAGG + Intergenic
971352738 4:25867510-25867532 AGAAAGCAGAAATAGAAGAGAGG + Intronic
971487947 4:27180233-27180255 AGAAAGCTGAGCCACAAGACAGG - Intergenic
973030569 4:45332271-45332293 GGAAAGCAGAGACAGAGGAGGGG - Intergenic
974050877 4:56940517-56940539 AGAAAGCTGAGGCACAAGAATGG - Intergenic
975035617 4:69676456-69676478 ACAAAGCAAAGACAGAAGAACGG + Intergenic
975083860 4:70312998-70313020 ATTAAGATGAGCCAGAAGATAGG + Intergenic
975506546 4:75144538-75144560 AGCTAGAAGAGCCAGGAGATGGG + Intergenic
975537079 4:75462110-75462132 AGAAAGCAGAGCAGGAAGTCAGG - Intergenic
975643489 4:76524184-76524206 AGGAAGAAGAGTCAGCAGATGGG + Intronic
976097380 4:81523535-81523557 ATAAAGTAGAGTCAGGAGATGGG + Intronic
976365540 4:84229057-84229079 AGAAAGCAGACCCTTAGGATGGG - Intergenic
976714389 4:88107951-88107973 AGGAAGCAGTGACAGGAGATGGG - Intronic
977431756 4:96939128-96939150 GGAAAGCAGAGCCACAAAGTGGG - Intergenic
977850353 4:101820197-101820219 AGAAAGATGAATCAGAAGATTGG - Intronic
979441994 4:120761203-120761225 AGAAAACAGCTCCAGAAAATTGG + Intronic
980170007 4:129277650-129277672 TGAAAGCAGAGAAACAAGATAGG - Intergenic
980273616 4:130619176-130619198 AGAAAGTAGATCCTGAGGATAGG - Intergenic
980753742 4:137128571-137128593 AGAAATCAGAGCCAGAAGACTGG - Intergenic
982321751 4:154084214-154084236 AAAAAACAGAGCCAGAAACTGGG + Intergenic
982930319 4:161396547-161396569 AGGAAGCAGAGGCAGGAGAATGG + Intronic
983113245 4:163780203-163780225 AGAATGCAGAGCCCCAAGAAGGG + Intronic
983168011 4:164501059-164501081 AGAAAACAGAACAAGAAAATGGG - Intergenic
983208359 4:164933654-164933676 CGGAAGCAGAGGCAGAAGAATGG - Intergenic
984726228 4:183024141-183024163 AGAAAGCTGAGGCAGGAGAATGG + Intergenic
985584731 5:724603-724625 AGAAAGCAGATCAAGAGGACAGG - Intronic
986152976 5:5144769-5144791 AGAAAACAGAGACAGAAGGGTGG - Intronic
986282381 5:6334205-6334227 TGAAAGCAGCCACAGAAGATGGG - Intergenic
987167700 5:15218649-15218671 AACACACAGAGCCAGAAGATGGG - Intergenic
987550158 5:19369175-19369197 GCAAGGCACAGCCAGAAGATGGG - Intergenic
987619832 5:20326641-20326663 AGAAAGCTGAGGCAGGAGAATGG - Intronic
988038417 5:25857894-25857916 TGAATGGAGAGCCAGAAGAGGGG - Intergenic
988405095 5:30814282-30814304 AAAAAGGAGAGGCAGAAGTTAGG - Intergenic
988464948 5:31480854-31480876 AGAAAGGAGAGAAGGAAGATGGG + Intronic
989179255 5:38559836-38559858 AGAAAGAAGAGCCAGTAGCTGGG - Intronic
989564688 5:42890250-42890272 AGAAAGCAGAGGCTGAAGCTAGG - Intergenic
989998549 5:50864583-50864605 AGAAAGAGAAGACAGAAGATTGG + Intergenic
990101995 5:52202285-52202307 AGGAGGCTGAGCCAGAAGAATGG - Intergenic
991070180 5:62469205-62469227 AGAAAGCATATCCAGAATAAGGG + Intronic
992952628 5:81875614-81875636 AGAAAGAAGACTCAGTAGATAGG + Intergenic
993538749 5:89121949-89121971 AGAAAGCTGAGGCAGGAGAATGG - Intergenic
993810985 5:92475301-92475323 AGAAAGCAGAAGATGAAGATGGG - Intergenic
994279102 5:97878673-97878695 AGAAAATAGAGACAGAAGAAGGG - Intergenic
994716373 5:103326736-103326758 GGAAAGCATAGGCAGAAGAAGGG + Intergenic
994912359 5:105927792-105927814 AGGAAGCTGAGCCAGGAGAATGG + Intergenic
994926275 5:106120952-106120974 AGAGAGCAGAGCCAGAAGGCGGG - Intergenic
996258848 5:121440612-121440634 AGAAATAAAAGCCAGAAGACAGG + Intergenic
997270663 5:132534834-132534856 AGAAAGCAGAGCCTGAAGTCAGG - Intergenic
998090219 5:139362021-139362043 AAAAAGCAGACACAGAATATGGG + Intronic
998228211 5:140342959-140342981 AGAAGGAAGAGCAGGAAGATTGG + Intronic
998428501 5:142050119-142050141 AGATGGCAGAGCAACAAGATAGG + Intergenic
998738051 5:145165606-145165628 GCAAAGCAGACCCAGAAGATAGG - Intergenic
998817893 5:146032060-146032082 AGGAAGCAGAGATAGATGATGGG - Intronic
1000128449 5:158270724-158270746 AGAAAACAGAGGCAGAGCATGGG + Intergenic
1001933089 5:175686986-175687008 AGAAACCAGGGCCAGCAGAGAGG + Intergenic
1003146544 6:3514868-3514890 AGAGAGCACAGCAAGAAGCTGGG + Intergenic
1003571684 6:7260415-7260437 AGAAAGCAGAACCAGGAGATGGG - Intergenic
1004020258 6:11770552-11770574 GGGTAGAAGAGCCAGAAGATAGG + Intronic
1004460408 6:15829836-15829858 GGAATGCAGAGCTAGAAGAGAGG - Intergenic
1005172021 6:22998359-22998381 AGAATGAAGAACCAAAAGATGGG - Intergenic
1005764712 6:28999663-28999685 AGGAAACAGAGGCAGAAGAAAGG + Intronic
1006945176 6:37779845-37779867 AGAGAGCAGGGACAGGAGATGGG - Intergenic
1007494819 6:42252510-42252532 CCAAAGGAGATCCAGAAGATAGG + Intronic
1008274774 6:49530129-49530151 AGAAGGAGCAGCCAGAAGATAGG + Intergenic
1008518868 6:52344163-52344185 AGAAAGGAAAGACAGAAGAAAGG + Intergenic
1009670948 6:66748826-66748848 AGAAAGCAAAGCAACAAGACTGG - Intergenic
1009923587 6:70093424-70093446 AGAAAACAGAGCCAGAAGTTGGG + Intronic
1011358636 6:86498634-86498656 GAAAGGCAGAGCTAGAAGATGGG + Intergenic
1012639717 6:101594472-101594494 AGAAAGCACAACCATAAAATGGG + Intronic
1012743082 6:103045613-103045635 AGAATGCAGAGGTAGAACATAGG + Intergenic
1012804710 6:103879222-103879244 GGAAAGGAAAGCCAGAAGACTGG + Intergenic
1012809211 6:103936594-103936616 AGAAAGCACACACAGAAAATTGG + Intergenic
1012948152 6:105489710-105489732 AGAAAGGAGACCAAGAAGAGAGG - Intergenic
1013176743 6:107684278-107684300 AGAAAGCAGACCTTCAAGATGGG + Intergenic
1013183795 6:107739976-107739998 AGAAATCAGTGCCACAAGGTTGG + Intronic
1013773283 6:113650885-113650907 AGAAAGGAGAGCAAGAAGGAAGG - Intergenic
1014305265 6:119733436-119733458 TGAAAGTAGAGCCAGAAGGTAGG - Intergenic
1014714799 6:124850803-124850825 AGAAAGCAGAATCAGGTGATGGG - Intergenic
1014743463 6:125172047-125172069 AGAAAGAAGAGAAAGAAGGTGGG - Intronic
1014770792 6:125455891-125455913 AGGAAGCTGAGGCAGAAGAATGG + Intergenic
1014886955 6:126793543-126793565 AGAAAGCAGAGCCTGAGGCAAGG + Intergenic
1015868838 6:137755281-137755303 AGTAAGCAGAGAAAGAAGAAAGG + Intergenic
1016182182 6:141160487-141160509 GGAAGGCACAGCCAGAATATGGG + Intergenic
1016283232 6:142443898-142443920 AGAAAGAAGATGCAGAAAATGGG - Exonic
1016506668 6:144789213-144789235 AGAGTGCAGAGTCTGAAGATTGG + Exonic
1016529800 6:145044902-145044924 TGAAAGCAGAGCCAAAAACTAGG - Intergenic
1016688995 6:146914023-146914045 AGCCAGCAGAGCCAGCAGAGTGG - Intergenic
1016845923 6:148568723-148568745 AGAAGGCAGAACTAGAAGTTAGG + Intergenic
1016863374 6:148743844-148743866 AGAAAGCAGAGGGTGGAGATGGG + Intergenic
1017292629 6:152758352-152758374 AGAAAGCAGAGGCAGGAGTGTGG + Intronic
1017759351 6:157556222-157556244 GGAAAGCAGAGCCAGCAGAGAGG + Intronic
1017786604 6:157762035-157762057 AGGGAGCACGGCCAGAAGATGGG + Intronic
1018380203 6:163252175-163252197 AGGAAGCAGAGCCAAGAGACAGG + Intronic
1018502819 6:164430503-164430525 TGAAAGCTGAGGAAGAAGATGGG + Intergenic
1019041125 6:169107157-169107179 TGAAAGCAGATCCAGGAGAGGGG + Intergenic
1019862224 7:3669890-3669912 AGAAAGGAGAGCCAGGAGTAAGG - Intronic
1020054606 7:5108657-5108679 AGAAGGCTGAGGCAGAAGAATGG + Intergenic
1020206332 7:6120067-6120089 AGGAAGCTGAGGCAGAAGAATGG - Intronic
1021141196 7:17027919-17027941 AGAAAGCAGAGCCTGAGGCAAGG + Intergenic
1021423423 7:20471459-20471481 AGAAACCTGAGCAAGGAGATGGG - Intergenic
1021457496 7:20845462-20845484 AGAAATAAGAGCCAAAAGAAAGG - Intergenic
1021541844 7:21768408-21768430 TGAAAGCAGAGCCAGATGAAAGG + Intronic
1021865249 7:24949898-24949920 TGAAAGCAGAGCCTGAAGCAAGG - Intronic
1022334749 7:29411757-29411779 AGAAAGTAGAGCCTGGAGATGGG + Intronic
1022679342 7:32529241-32529263 AGAAAGCAGAAACAGAACAAAGG + Intronic
1023162382 7:37309776-37309798 AGAAACCAGAGCTGGAAAATAGG + Intronic
1023329427 7:39099017-39099039 AGAAAGCAAAGACTGAAGAAGGG - Intronic
1024329718 7:48143884-48143906 AAAAGGCAGATCTAGAAGATGGG - Intergenic
1024586659 7:50848214-50848236 AGAAAACAGAGCCATAAAGTAGG + Intergenic
1026602212 7:71786149-71786171 AGAAAGCTGAGCAGGAAGACAGG + Exonic
1027463934 7:78490973-78490995 AGAAATCAGAGCCAGGTAATAGG + Intronic
1027541800 7:79476378-79476400 AGAAAGCAGACCATAAAGATGGG + Intergenic
1027865027 7:83634797-83634819 AGAAAGTAGATGGAGAAGATAGG - Intronic
1028053293 7:86210619-86210641 ATAAAGCAGAGAAGGAAGATAGG + Intergenic
1028151477 7:87378517-87378539 AGAAAGCAGTACCAAAAAATGGG - Intronic
1028188124 7:87813654-87813676 AGAAAGGAAAGCAAGAACATAGG - Intronic
1028608874 7:92685910-92685932 AGAAAGCAGAAACAAAAGAACGG - Intronic
1030491392 7:110239607-110239629 AATAAGTAGAGCCCGAAGATGGG + Intergenic
1030507979 7:110448457-110448479 AGAAAGGAGATCCAGCAGAAAGG + Intergenic
1030640943 7:112005798-112005820 AGAGAGGAGAGCCAGAAGTGCGG - Intronic
1030968204 7:116020116-116020138 AGAAAGTGGGGCCAGAGGATAGG + Intronic
1031910135 7:127507674-127507696 AGAGAGCAAAGACAGAAGATAGG + Intergenic
1033184946 7:139218871-139218893 ACAGAACAGAGCCAGAAGAGGGG - Intergenic
1033890704 7:146009385-146009407 TGAAAGAAGAGCAGGAAGATGGG + Intergenic
1035907343 8:3527666-3527688 CAAAAGCAGAGCCAGCAAATTGG - Intronic
1036282574 8:7414472-7414494 AGAAACCTTAGCCAGAAGAAGGG + Intergenic
1036338898 8:7897077-7897099 AGAAACCTTAGCCAGAAGAAGGG - Intergenic
1036574682 8:10015591-10015613 AGAAAGCAGAGCCTGAGGCAAGG - Intergenic
1037350165 8:17944744-17944766 AAAAAACTGAGCCAAAAGATGGG - Intronic
1037460738 8:19106472-19106494 AGAAATCAGAGACAAATGATAGG - Intergenic
1037874319 8:22532817-22532839 AGACAGCAGAGATGGAAGATAGG - Intronic
1038137158 8:24799254-24799276 GAAAAGCAGAGGCAGAAGAATGG + Intergenic
1038402244 8:27293545-27293567 AGAAAGAAGAGACAGGAGCTGGG + Intronic
1039082407 8:33745796-33745818 AGAAAGCAGAGCATAAAAATTGG - Intergenic
1039277215 8:35946534-35946556 TCAAAGCAGAGGCAGAAAATTGG + Intergenic
1039571198 8:38587753-38587775 TGAAGTCAGAGCCAGGAGATTGG + Intergenic
1040407951 8:47127125-47127147 ATAAAGCAGAGGCAGAAGAGAGG - Intergenic
1041331926 8:56736016-56736038 AGAAAGCTATGCCAGTAGATGGG - Intergenic
1041725705 8:61015653-61015675 AGAAAGCAGAGCAAAAGGGTGGG + Intergenic
1041816915 8:61983791-61983813 ACAAAGAAGAGACAGATGATTGG + Intergenic
1042030367 8:64469566-64469588 AGAAAGCAGAGGAAGGAGAAAGG - Intergenic
1042341356 8:67683388-67683410 AAATAGCAGAGCCTGAGGATAGG - Intronic
1042619414 8:70688519-70688541 AGAAGGCTGAGGCAGAAGAATGG - Intronic
1042664861 8:71193853-71193875 AGAAAGAAAAGGCAGAGGATAGG - Intergenic
1042810376 8:72819197-72819219 AGAAAGCAGAGCAACAAAATGGG - Intronic
1043659387 8:82717066-82717088 AGAAAGAAGAGAAAGAAGAAAGG + Intergenic
1044739658 8:95313228-95313250 AGGAAGAGGAGCCAGAAGAGGGG + Intergenic
1044875957 8:96666566-96666588 AGAAAATAAAGCCAGAACATGGG + Intronic
1045295973 8:100872010-100872032 TGAAAGCAGCTCTAGAAGATGGG - Intergenic
1046048883 8:108997054-108997076 AGAAACAAGAGCCAGAGGAATGG - Intergenic
1047370903 8:124254994-124255016 AGGAAGCTGACTCAGAAGATGGG - Intergenic
1047476937 8:125241657-125241679 AGGAAGCAGAGTCAGAGGTTGGG + Intronic
1047712033 8:127562060-127562082 TGAAAAAAGAGCCTGAAGATGGG + Intergenic
1048493910 8:134919882-134919904 CGAGAGCAGAGCCACAACATGGG - Intergenic
1048569253 8:135637782-135637804 AGAAAACTGAGACAGAAGACAGG - Intronic
1048685456 8:136900169-136900191 AGGAAGCAGAGGCAGGAGAATGG - Intergenic
1048734893 8:137488242-137488264 TGAAAGCATGGCCAGAACATGGG + Intergenic
1049026472 8:139994117-139994139 AGAAAGCAGAGCCTGAGAAAAGG + Intronic
1049341446 8:142114741-142114763 CGAAAGCAGAGCTTGAAGACCGG + Intergenic
1049554279 8:143274437-143274459 AGTAAGCAGAGCCAAAACCTGGG - Intronic
1049629729 8:143647097-143647119 AGAAAGCAGAGGCAGGAGAGAGG + Intronic
1049920386 9:357834-357856 AGAAATCAGAGCAAGAAAAATGG - Intronic
1050343975 9:4667987-4668009 AGAAAGAATAGCCAGAAAGTTGG - Intergenic
1050700505 9:8333242-8333264 AGGAAGGAGACCCAGAAGCTAGG + Intronic
1050815969 9:9811600-9811622 AGAAGGCTGAGGCAGAAGAACGG + Intronic
1051107796 9:13600119-13600141 AGAAAACTGAACCAGAAGAAAGG - Intergenic
1051786354 9:20748546-20748568 AAAAATCAGAGAAAGAAGATGGG + Intronic
1052190326 9:25653974-25653996 TGAAAGCAGAGCCTGAAGCAAGG - Intergenic
1052301644 9:26958905-26958927 AGAAAAAAGAACCAGAAGAGAGG + Intronic
1053163197 9:35827911-35827933 AGAGTGGAGAACCAGAAGATGGG + Intronic
1054714671 9:68545728-68545750 AGAAGGCAGATCCAGAAGATAGG - Intergenic
1054805979 9:69396082-69396104 AGAATGCAGAGCAGGAAGAGGGG + Intergenic
1055118910 9:72635699-72635721 AGAAAGCATAGAAAGAAGCTAGG + Intronic
1055636736 9:78286588-78286610 GGAAAGCAGAGCAATCAGATTGG - Intergenic
1055638912 9:78304222-78304244 AGAAAGCAGAGCCAGAAGATGGG - Intronic
1055720540 9:79168199-79168221 GGAAAGGAGAGCTAAAAGATGGG + Intergenic
1056041302 9:82670173-82670195 AGGAAGCCCAGGCAGAAGATTGG - Intergenic
1056760322 9:89409874-89409896 AGAGTCCAGAGCCAGGAGATGGG + Intronic
1057730840 9:97606924-97606946 AGACAGGAAAGCTAGAAGATGGG + Intronic
1057962224 9:99467808-99467830 AGAAAGAAGAGGAGGAAGATGGG + Intergenic
1058876968 9:109252777-109252799 AGAAAGAAGAGCTACAAGATGGG + Intronic
1059720791 9:116958482-116958504 AGGAAGCTGAGGCAGAAGAATGG + Intronic
1060049239 9:120365600-120365622 AGAAAGGAGAGAGAGAAGAGGGG + Intergenic
1060265615 9:122110102-122110124 AGAAAACAGAGGCTGAAGCTTGG - Intergenic
1061038938 9:128128546-128128568 CGAAAGCGGAGCGAGAAGAGTGG - Intergenic
1061388061 9:130302032-130302054 AAAAAGCACAGCTAGAGGATGGG - Intronic
1061574758 9:131499191-131499213 CGAAGGCAGATCCAGAAGATAGG - Exonic
1062161263 9:135081462-135081484 AGAAAGCAGGGCAAGAAGGAGGG + Intronic
1062549795 9:137080739-137080761 AGAACGCAGAGCCAGCCGACAGG + Exonic
1062623355 9:137432473-137432495 AGGAGGCAGAGCCAGGAGAATGG + Intronic
1203529319 Un_GL000213v1:123805-123827 ATAAAGCAGAGGAAGAAGAGAGG - Intergenic
1185568573 X:1115249-1115271 AGAAAACATCACCAGAAGATGGG + Intergenic
1186197916 X:7128528-7128550 AGAAAGCAGAGCATGAAAAAGGG + Intronic
1186253335 X:7692870-7692892 AGAAAGCAGAACCTGAGGAGAGG + Intergenic
1186341454 X:8650357-8650379 AGAAATCAGAGCTAGAAGATGGG + Intronic
1186909050 X:14142057-14142079 ACAAACAAGAGCCAGAAGAGAGG - Intergenic
1187012932 X:15298409-15298431 AGAAAGTAGAAGCAGGAGATGGG + Intronic
1187736266 X:22307050-22307072 AGAGAGGAGGGCCAGAGGATGGG - Intergenic
1187997190 X:24940349-24940371 ATAAAGCAGAGCCTCTAGATTGG - Intronic
1188867491 X:35331515-35331537 AGAAAGCACAGACACAGGATGGG - Intergenic
1189155483 X:38752190-38752212 AGAAAACACAGGCAGAAGACTGG - Intergenic
1189201896 X:39203620-39203642 AGCAAGCAGGGGCAGGAGATGGG + Intergenic
1189335188 X:40166796-40166818 GGAAGGCAGAGCCAGATGACTGG - Intronic
1189579506 X:42390840-42390862 AGAGAGCAGGGGAAGAAGATTGG - Intergenic
1190966569 X:55306763-55306785 AGAATTCAGAGCCTGAAGACTGG - Intergenic
1193127287 X:77883402-77883424 AGAAAGAATAGCCAGAAGTCTGG - Intronic
1193159626 X:78214061-78214083 GGAAAGCAGATCTAGAAGATGGG + Intergenic
1194536056 X:95106979-95107001 GTAAAGCAGAGCCAGGAGAGTGG - Intergenic
1194853963 X:98905444-98905466 AGAAAGCAGAACCAAAAAAAAGG + Intergenic
1195277667 X:103298142-103298164 AGGAAGCAGTTACAGAAGATAGG - Intergenic
1195608424 X:106835602-106835624 AGGAAGCAGAGCAAAAAGTTTGG - Intronic
1195907264 X:109856762-109856784 AGAAGGCAGAGAGAGAGGATGGG + Intergenic
1196941380 X:120779595-120779617 AGGAAGCAGAACCGTAAGATGGG + Intergenic
1200665589 Y:6018241-6018263 AGAAGGCTGAGGCAGAAGAATGG - Intergenic
1200843932 Y:7812106-7812128 AGAAAGCAGAGGCAAAAACTCGG + Intergenic