ID: 1055638913

View in Genome Browser
Species Human (GRCh38)
Location 9:78304223-78304245
Sequence AAGAAAGCAGAGCCAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 1, 1: 2, 2: 15, 3: 122, 4: 885}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055638913_1055638916 -1 Left 1055638913 9:78304223-78304245 CCATCTTCTGGCTCTGCTTTCTT 0: 1
1: 2
2: 15
3: 122
4: 885
Right 1055638916 9:78304245-78304267 TATGTGTTCTCTTCATTGGGTGG No data
1055638913_1055638914 -5 Left 1055638913 9:78304223-78304245 CCATCTTCTGGCTCTGCTTTCTT 0: 1
1: 2
2: 15
3: 122
4: 885
Right 1055638914 9:78304241-78304263 TTCTTATGTGTTCTCTTCATTGG No data
1055638913_1055638918 16 Left 1055638913 9:78304223-78304245 CCATCTTCTGGCTCTGCTTTCTT 0: 1
1: 2
2: 15
3: 122
4: 885
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data
1055638913_1055638917 9 Left 1055638913 9:78304223-78304245 CCATCTTCTGGCTCTGCTTTCTT 0: 1
1: 2
2: 15
3: 122
4: 885
Right 1055638917 9:78304255-78304277 CTTCATTGGGTGGCCACCATTGG No data
1055638913_1055638915 -4 Left 1055638913 9:78304223-78304245 CCATCTTCTGGCTCTGCTTTCTT 0: 1
1: 2
2: 15
3: 122
4: 885
Right 1055638915 9:78304242-78304264 TCTTATGTGTTCTCTTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638913 Original CRISPR AAGAAAGCAGAGCCAGAAGA TGG (reversed) Intronic
900938164 1:5780210-5780232 AGGAAAGCAGAGCCAGAGTTGGG + Intergenic
901286513 1:8083743-8083765 AAGGAATCAGACCCAGAAGGTGG - Intergenic
901586082 1:10294095-10294117 ATGAAAGAAGAGTCAGATGAGGG - Intronic
902677619 1:18019794-18019816 AAGGAAGCAGAGGCTTAAGAAGG + Intergenic
902690079 1:18105673-18105695 TAGAAAAGAGAGCCAGCAGAAGG - Intergenic
902965615 1:19999003-19999025 TGGAAAGCAGAGCCAGGAGAGGG + Intergenic
903107526 1:21095672-21095694 AGAAAATCAGAGCCAGAACAAGG - Intronic
903856182 1:26338632-26338654 GAGAAGGCAAAGCCAGAGGAAGG - Intronic
903907763 1:26697663-26697685 AAGAGAGAAGAGCCAGACAATGG - Intronic
904312382 1:29637250-29637272 AAGAAAGCAGAGAGATAAGATGG - Intergenic
904402036 1:30263265-30263287 AAGAAAGCAGAGAGAGAGGAAGG + Intergenic
904686667 1:32265825-32265847 AAAAAAGAAGAGGAAGAAGAAGG - Intronic
904727241 1:32558712-32558734 AAGAAAGGAGACACAGATGAAGG + Intronic
904859667 1:33526173-33526195 TAGAAAGGAGTGACAGAAGAAGG + Intronic
904910297 1:33929680-33929702 AAGAAAGCGGAGGCTGAAGCGGG - Intronic
905101560 1:35527753-35527775 AAAAAAGAAGAGCCAAAAGCAGG - Intronic
905403706 1:37719784-37719806 AAGCAAGCAGACAGAGAAGAGGG + Intronic
905778203 1:40684508-40684530 TAGAAAACAAAGCCGGAAGAAGG + Intergenic
906071580 1:43020692-43020714 AAGAAAGCCAAGCCAAAAGATGG - Intergenic
906262072 1:44400836-44400858 AAGGAGGCAGAGACAGAAGTGGG - Intergenic
906790766 1:48656988-48657010 AAGAAAGGAGTGCCAGCGGAAGG + Intronic
906900946 1:49835904-49835926 TAGAAGCCAGAACCAGAAGAGGG - Intronic
907124385 1:52036490-52036512 AGGATGGCAGAGGCAGAAGAGGG + Intronic
907335990 1:53699998-53700020 AAGGTCACAGAGCCAGAAGAAGG + Intronic
907446847 1:54513658-54513680 CAGAAAGCAAAGCCTGACGAAGG + Intergenic
907590899 1:55670024-55670046 AAGATGGCAGTGCCACAAGATGG + Intergenic
907607488 1:55832792-55832814 AAGAAAAGAATGCCAGAAGAGGG + Intergenic
908865110 1:68539537-68539559 AAAAAAACACAGCAAGAAGATGG - Intergenic
909078703 1:71083553-71083575 AAGAAAGAAAAACCAGAAGAGGG + Intergenic
909758054 1:79252405-79252427 AATAAAGCTGAACCAGAACAAGG - Intergenic
910098232 1:83548506-83548528 AGGACAGCAGGGCCAGATGACGG + Intergenic
910238441 1:85060394-85060416 AATAAGGCAGAGGCAGAGGATGG + Intronic
910954072 1:92682323-92682345 AAGAAAACAAAGCCAGATAAAGG - Intronic
910964295 1:92792683-92792705 AAGGAAGGAGGGACAGAAGAAGG - Intergenic
910983717 1:92983717-92983739 AAAAAAGTGGAGCCTGAAGATGG + Intergenic
911086375 1:93980727-93980749 AGGATAGCAGAGCCACAAGATGG - Intergenic
911228742 1:95336990-95337012 AAGAAAGCAGAGCCAGAGCAGGG - Intergenic
911720323 1:101183623-101183645 AAGAAAGCAAAACCAGAGGCAGG - Intergenic
912384391 1:109264040-109264062 AAGAAAACAGGGTCAGCAGACGG - Intronic
912898524 1:113621149-113621171 AAGAAAGCATACCAAGTAGAAGG + Intronic
912932162 1:113973546-113973568 AAGAACGCAGGGCCAGGAGAAGG - Exonic
913045399 1:115069563-115069585 AGGAAAGCAGGGCCAAGAGATGG + Intronic
913152676 1:116060879-116060901 GAGAAAGCAGCTCCAGAAGGTGG + Intronic
913249389 1:116899835-116899857 AAGATAACTGAGCCACAAGATGG - Intergenic
913373797 1:118129663-118129685 AAGAAGGTAGAGAAAGAAGAAGG - Intronic
913599092 1:120405737-120405759 GAGAAAACAGAGCAAGAAGCTGG - Intergenic
913706645 1:121431607-121431629 AAGAATGTAGAACCTGAAGAAGG - Intergenic
914088286 1:144473883-144473905 GAGAAAACAGAGCAAGAAGCTGG + Intergenic
914310325 1:146460327-146460349 GAGAAAACAGAGCAAGAAGCTGG - Intergenic
914379407 1:147102977-147102999 AAAAAAACAGAGCAAGAAGCTGG + Intergenic
914591784 1:149112815-149112837 GAGAAAACAGAGCAAGAAGCTGG + Intergenic
915181261 1:154062475-154062497 ATTAAAGCAGAGTCAGAATATGG - Intronic
915188879 1:154131474-154131496 GAGAAAGGAGAGCCAGTTGATGG - Intronic
915604408 1:156941627-156941649 AATAGAGCTGAGCCTGAAGAAGG - Intronic
915707290 1:157857066-157857088 TAGAAAGCAGTGCAAAAAGAAGG - Intronic
915904602 1:159868579-159868601 CAGAAAGAAGAGTCAGAAGTGGG - Intronic
916353272 1:163876205-163876227 AAGAAAATGAAGCCAGAAGAGGG - Intergenic
916664283 1:166951330-166951352 GAGAGTGCAGAGCCAGGAGATGG + Intronic
916827119 1:168453082-168453104 CAGAAAGCAGAGCAAGCGGATGG - Intergenic
916845947 1:168650135-168650157 AAGAGATCAGAGCCTGGAGAGGG - Intergenic
917482085 1:175421016-175421038 CAGAAAGCAGAGAAAGTAGAAGG - Intronic
917511798 1:175674965-175674987 AAGAAGGAAAAGCCAGGAGAAGG + Intronic
917840480 1:178973536-178973558 CAGAAATCAGTGCCAGAAAATGG + Intergenic
918006720 1:180548117-180548139 AAGAAGGCAGAGCCTGAAACTGG - Intergenic
918122729 1:181553935-181553957 AAGAAAGCAGAGCCACAGAGAGG + Intronic
918442710 1:184584012-184584034 GATAAAGCAGACCCAGCAGAGGG - Intronic
918544751 1:185669893-185669915 AAGAAAGCAGAGCCAGGAGATGG + Intergenic
918585634 1:186185014-186185036 AATAGACCAGAGACAGAAGAGGG + Intronic
919261575 1:195202282-195202304 AAGAAAGAAGAACCACCAGAAGG + Intergenic
919742765 1:200990704-200990726 CAGAAAGAAGTTCCAGAAGAAGG - Exonic
920100285 1:203513123-203513145 GAGAAAGGAGACCTAGAAGAGGG + Intergenic
920162872 1:204013055-204013077 GAGAAAACAGAGCCAAGAGAGGG + Intergenic
920336489 1:205248704-205248726 AAAAAAGAAGAGGGAGAAGAGGG - Intronic
920787906 1:209060306-209060328 AAGAAAGTACAGCCAGGGGATGG + Intergenic
922643010 1:227255003-227255025 AAGAAATAAGAGCTAGAAAATGG + Intronic
922761667 1:228136154-228136176 AAGAAAGAAGAGGAAGAAGGAGG + Intergenic
923254984 1:232214081-232214103 AAGAAAGCAGAGGCAGGAGCTGG + Intergenic
923329907 1:232913415-232913437 AAGGATGCAGAGCCAGGAGGGGG + Intergenic
923714655 1:236414959-236414981 AAGAAGACAGAGCCATGAGATGG - Intronic
923988379 1:239407276-239407298 AGGACAGCAGATTCAGAAGATGG - Intronic
924032009 1:239895201-239895223 AAGGAAGTACAGCCAGGAGAAGG - Intronic
1063362411 10:5469187-5469209 AAGGAAGAAGAGACAGAGGAAGG - Intergenic
1064771637 10:18729490-18729512 AAGAAAGCAGAAACAGAAAACGG + Intergenic
1064827277 10:19419255-19419277 AAGAAAGAAGATGAAGAAGAAGG - Intronic
1064836174 10:19533636-19533658 GTGAAAGCAGAGGCAAAAGAGGG + Intronic
1065257569 10:23887097-23887119 AAGATAAGAAAGCCAGAAGATGG - Intronic
1065702965 10:28443420-28443442 AAGAAAGAAGAACCTGCAGATGG + Intergenic
1065761934 10:28990660-28990682 ACAAAAGCAGGGCCAAAAGAAGG - Intergenic
1066248006 10:33603309-33603331 AAGAAATGAGAGGCAGGAGAAGG + Intergenic
1066254685 10:33667057-33667079 AAGAAAGCAGAACCAGAGGATGG + Intergenic
1066304363 10:34125621-34125643 AAGCAGGCAGAGCCCTAAGAGGG + Intronic
1066334500 10:34462811-34462833 AATAAAGCAGAGCCAGACAGTGG + Intronic
1066461106 10:35613072-35613094 CACACAGCAGAGCCAAAAGAAGG + Intergenic
1066989363 10:42497477-42497499 TGGAAAGCAGAGCTAGGAGAGGG + Intergenic
1067275001 10:44826481-44826503 AGGAGAGCAGGGCCAGAGGAGGG + Intergenic
1067337514 10:45377341-45377363 AAGGAAGAGGAGGCAGAAGAGGG - Intronic
1067979243 10:51064881-51064903 GAGAAAGCAAAGCAAGAACAAGG + Intronic
1068453070 10:57218279-57218301 AAGAAAGAAGAGGAAGAAGGAGG + Intergenic
1068504965 10:57888988-57889010 AAGAAAGCAGAGCAAGCGGGGGG - Intergenic
1068583976 10:58775759-58775781 TAGAAAGTAGAGTGAGAAGAAGG + Intronic
1069144938 10:64879794-64879816 AAGAAAGCACAGACAAGAGATGG - Intergenic
1069435515 10:68378688-68378710 AAGAAATCAAAGACAGAAAAAGG + Intronic
1070410053 10:76131207-76131229 AAAAAGGCAGAGACAGAAGAAGG - Intronic
1070533376 10:77357066-77357088 AAGAAAGCAGAGGTAAGAGATGG + Intronic
1070540844 10:77414104-77414126 AAGAAACCTGAGGCACAAGATGG - Intronic
1072910264 10:99494712-99494734 AAGAAAGAAGAAGGAGAAGAAGG - Intergenic
1073181096 10:101583705-101583727 AAGAAAGAAGAGTGAGGAGATGG + Intronic
1074139777 10:110661641-110661663 AAGAAAGCAGGGTGAGAGGAAGG + Intronic
1074139926 10:110662944-110662966 AAGAAAGCAGGGTGAGAGGAAGG - Intronic
1075182690 10:120225955-120225977 AAGAAACCAAAACCAGCAGAGGG + Intergenic
1075391681 10:122096846-122096868 AAGAAAGCAGAGAAGAAAGAAGG - Intronic
1075810016 10:125218512-125218534 AAGAAAACTCTGCCAGAAGAGGG - Intergenic
1075850059 10:125579553-125579575 ACCAAATCAGAGCAAGAAGATGG - Intronic
1076207313 10:128613431-128613453 AAGAAAGCAGAACCAAGGGATGG + Intergenic
1076250091 10:128978490-128978512 AAGAACTCAGAGCCAGGAGGAGG + Intergenic
1076870881 10:133193562-133193584 AAGGAAGAAGAACAAGAAGAAGG + Intronic
1077199515 11:1298507-1298529 AAGAGTGCAGAGCAAGGAGATGG - Intronic
1077713065 11:4554873-4554895 AAGAAGGTAGAGGAAGAAGAGGG + Intergenic
1077986489 11:7356443-7356465 AAGAAAACAGAACCAGCAGAAGG - Intronic
1078630156 11:12995309-12995331 GAGATAGCAGAGCCAGGAAATGG - Intergenic
1078948557 11:16100924-16100946 AATAAAACAGAACTAGAAGACGG + Intronic
1079167269 11:18056784-18056806 AAGATGGCCGAGCCACAAGATGG - Intergenic
1079806815 11:24941931-24941953 AAGAAAGCAGGGCATGGAGAGGG - Intronic
1080396945 11:31898928-31898950 AAGGGAGCAGAGCCATAAAAGGG - Intronic
1080533282 11:33197571-33197593 AAAATAGCAGAGCCAGGAGATGG + Intergenic
1080622228 11:33996428-33996450 AAGAATCCAGAGACAGGAGAAGG + Intergenic
1080623159 11:34004590-34004612 AGGAAAGCAGAGCCAAGAGGTGG - Intergenic
1081327328 11:41760785-41760807 AAGAAGGCAAAGGCAGAACAAGG + Intergenic
1081619542 11:44611251-44611273 AAGTAGCCAGAGCCAGCAGAAGG + Intronic
1083400196 11:62418255-62418277 AAGAAGGAATGGCCAGAAGAAGG + Intronic
1084499043 11:69524051-69524073 AGGACACCAGAGCCAGAAGGAGG + Intergenic
1084775635 11:71372927-71372949 GAGAAGGCAGACCCAGAAGACGG + Intergenic
1085169941 11:74441221-74441243 AAGACAAAAGAACCAGAAGAAGG + Intergenic
1085484378 11:76849457-76849479 AAGGGGGCAGAGCAAGAAGAAGG + Intergenic
1085618826 11:78022512-78022534 GAGAAAGCAGATCCAGCAGCAGG - Intronic
1085750766 11:79159122-79159144 CAGAATGCAGAGCTATAAGAGGG + Intronic
1085939295 11:81189312-81189334 AAGAAAGGATAGAAAGAAGAAGG + Intergenic
1086071772 11:82807234-82807256 GAGGAAGCAGAAGCAGAAGAAGG + Intergenic
1086517092 11:87625269-87625291 AGGGAAGCAGAGGGAGAAGAGGG - Intergenic
1086831041 11:91563912-91563934 AAGAGATCAGAACCAGAAGCTGG + Intergenic
1087243173 11:95803418-95803440 AAGAAAGTAGAGGGAGAAAAGGG + Intronic
1087283853 11:96243301-96243323 AAGGAAGCAGAGCAAGGAGGCGG + Intronic
1087430011 11:98041631-98041653 AAGAAAGAGCAGGCAGAAGAAGG - Intergenic
1087947125 11:104176370-104176392 AACCAAGCAGAACCAAAAGATGG + Intergenic
1087990191 11:104739973-104739995 AGGAAAGAACAGGCAGAAGATGG + Intergenic
1088115677 11:106310124-106310146 AGTGAAGCAGAGCCAGGAGATGG + Intergenic
1088185936 11:107169950-107169972 AAGAAAGAAGAGACAGAATACGG - Intergenic
1088402110 11:109432538-109432560 AAGAAAGGAGAGGCAGAGAAAGG + Intergenic
1088593992 11:111426242-111426264 ATGAAAGCAGTGACAGAGGAAGG + Intronic
1088676307 11:112196998-112197020 AAGAAAGCAAAAGAAGAAGAAGG - Intronic
1088767839 11:113001892-113001914 AGGGAAGCACAGCCAAAAGATGG - Intronic
1089141214 11:116286093-116286115 ATGAAAGCAGAGAAAGACGAAGG - Intergenic
1089173553 11:116532768-116532790 CAGAAAGCAGAACCAGAAAGGGG + Intergenic
1089192566 11:116663785-116663807 TAGAAAACAGAGCAAAAAGATGG + Intergenic
1089527456 11:119106869-119106891 GAGAAAGCAGAACCTGAAGCTGG - Intronic
1090907958 11:131094138-131094160 AAGAAAGAAAAGGAAGAAGAGGG - Intergenic
1092305525 12:7296950-7296972 AAGAAAACACAGCCAGCAAAAGG - Intergenic
1092443823 12:8534588-8534610 AAGAAGGAAGAGCAAGAACATGG - Exonic
1092458890 12:8669643-8669665 AGGAAAGCAGAGAGAAAAGAAGG + Intergenic
1093279936 12:17180837-17180859 AGGATAGTAGAGCCAAAAGACGG + Intergenic
1095443372 12:42260190-42260212 AAGAAAGAAGAGAGAGAGGAAGG + Intronic
1095674865 12:44904432-44904454 AAGAAAAGAGAGACAGAATATGG - Intronic
1095840041 12:46682982-46683004 AAGTAGGCAGAGCCAGAGGTTGG - Intergenic
1096017946 12:48295656-48295678 AAGAAAGAAGAAGAAGAAGAAGG + Intergenic
1096099775 12:48963157-48963179 AAGAAAGAAAAGAAAGAAGAAGG + Intergenic
1096695490 12:53345678-53345700 ATGATAGCAGGGCCAGAAGAGGG + Intergenic
1096815606 12:54200054-54200076 TAGAAAGTAGAGCCAGAGAAGGG + Intergenic
1097608150 12:61781227-61781249 AGGATAGAAGAGCCAGGAGAGGG + Intronic
1097924501 12:65112499-65112521 AAGAAAGAAGAGCTAAATGAGGG + Intronic
1098044054 12:66381826-66381848 AACAAAGCAGAGAAAGAAAAGGG + Intronic
1098167323 12:67711689-67711711 AATAAAGCTCAGGCAGAAGATGG + Intergenic
1098307341 12:69115316-69115338 AAGAAAGGAGAAGGAGAAGAAGG + Intergenic
1098307350 12:69115369-69115391 AAGAAAGGAGAAGGAGAAGAAGG + Intergenic
1098356030 12:69613473-69613495 AAATAAGCAAAGCAAGAAGAGGG - Intergenic
1098858154 12:75677576-75677598 AAGAAAGCAGATCAAGAACTGGG + Intergenic
1099461827 12:82931672-82931694 AAGAAACCAGAGCCACAAAATGG - Intronic
1099783972 12:87237046-87237068 AAGAAGCTAGAGCCAGAAAAGGG + Intergenic
1100212117 12:92408315-92408337 AAGAAGGAAGAGCCACAAGATGG + Intergenic
1100277988 12:93089549-93089571 AAGAAAACATAGCCAGAAAATGG - Intergenic
1100777836 12:97991757-97991779 AAGACAGATGAGCCAGAAAAAGG - Intergenic
1100862575 12:98822042-98822064 AGGACAGCAGAGCCAAGAGAAGG + Intronic
1100892982 12:99146747-99146769 AAGAAAGCAGATACCGAGGAAGG - Intronic
1101512979 12:105409325-105409347 AAGAAAACAGAGGCATAAAAAGG - Intergenic
1102619589 12:114183375-114183397 ATGACAGCAGAGGCAGGAGAAGG + Intergenic
1102663858 12:114553333-114553355 AAGATCGCGGAGCCAGAAAAGGG - Intergenic
1102775108 12:115511829-115511851 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1102783635 12:115586016-115586038 CAGAAGGCAGAGCCAAGAGAGGG + Intergenic
1103018803 12:117517091-117517113 AAGAAGGCAAATCCAAAAGAAGG + Intronic
1103044827 12:117727404-117727426 AAGAAAGAAGAAGGAGAAGAAGG + Intronic
1103061679 12:117863378-117863400 AAGACAGCAGAGCCAAGAGATGG + Intronic
1103180548 12:118907508-118907530 AAGAAAGATGAGTGAGAAGAAGG + Intergenic
1103235343 12:119368059-119368081 AAAAAAGAAGAACAAGAAGAAGG + Intronic
1103369095 12:120404610-120404632 AAGAAAGCAGAGTCAAGACATGG + Intergenic
1103845697 12:123900763-123900785 AAGACAGCAGAGCCAAGAAAGGG - Intronic
1103860223 12:124006426-124006448 AAGAAAGGGGAACCTGAAGACGG - Intronic
1103957924 12:124588993-124589015 AAGTAAGTAAAGCCTGAAGATGG - Intergenic
1104145893 12:126033404-126033426 AAAAAGGCAGATCTAGAAGATGG - Intergenic
1104324143 12:127779938-127779960 AAGAATGCAAAGCAAGAGGAGGG + Intergenic
1104580419 12:130007320-130007342 AGGAAAGCAAAGCCAGGGGATGG + Intergenic
1104714410 12:131006777-131006799 AAGAAATCTGACGCAGAAGACGG - Intronic
1105486192 13:20835157-20835179 AAGAAAGTAGAGGCAGCACATGG - Intronic
1106472739 13:30072096-30072118 AAGGAAGCAGAGCTGGGAGATGG + Intergenic
1106824020 13:33499741-33499763 AAGAAAGAAGAAGAAGAAGAGGG - Intergenic
1106849009 13:33768203-33768225 AAGTAAGAAGAGACTGAAGAGGG + Intergenic
1108009747 13:45993536-45993558 AAGCAGGCAGAGCCAGATGTGGG + Intronic
1108021880 13:46136038-46136060 AAGGAAGCAGAGAGGGAAGAAGG - Intronic
1108116832 13:47137955-47137977 CAGAAAGCAGAGCAAGACCAAGG - Intergenic
1108264744 13:48695287-48695309 AAGAAAGAAGAAAGAGAAGAAGG - Intronic
1108397146 13:50000517-50000539 AAGAAAGCATATCCACAACATGG + Intronic
1108722196 13:53143627-53143649 AGGAAATCAGAGGGAGAAGATGG - Intergenic
1108787529 13:53923411-53923433 CAGAAAGCAAATGCAGAAGACGG - Intergenic
1108823651 13:54385187-54385209 AAGAAAGAACAGTCATAAGAGGG + Intergenic
1108892970 13:55284802-55284824 AAGAAAGAAGAAGCAGGAGAAGG + Intergenic
1109005117 13:56864312-56864334 AAGAAAGAAGACCCATAACACGG + Intergenic
1109653644 13:65361845-65361867 AAGAAAGCAGAGTCAAGACAAGG + Intergenic
1110015202 13:70391449-70391471 AAGAAAGCAGATTAAGAAGATGG - Intergenic
1110298211 13:73894949-73894971 GAGAAAACAGAGATAGAAGAAGG - Intronic
1110550667 13:76807898-76807920 AAGATGACAGAGCCACAAGACGG + Intergenic
1110918678 13:81056984-81057006 AGGAAAGAAGAGCAAGAGGAAGG + Intergenic
1111255311 13:85660169-85660191 AGCAAAGCAGGGCCAGATGAAGG - Intergenic
1112052989 13:95662699-95662721 AAGAAAGCAGTTCAAGAAGGAGG - Intergenic
1112152555 13:96780017-96780039 TAGAAAGCAGAGTGAGCAGAGGG + Intronic
1112199525 13:97261505-97261527 TGGAAAGCAGAGGCAGAAAAAGG - Intronic
1112336381 13:98520565-98520587 AAGAAAGATGACACAGAAGAGGG + Intronic
1112501786 13:99948535-99948557 AAAAAGGCAGAGCCAGAGGCAGG + Intergenic
1112551916 13:100429228-100429250 AAGCAAGCAGAGAGAGAAAAGGG - Intronic
1112698527 13:101977556-101977578 AAGAAAGCAAAGAAGGAAGAAGG - Intronic
1113588318 13:111480784-111480806 AGGAATGGGGAGCCAGAAGAAGG - Intergenic
1114231903 14:20790722-20790744 ATGAATGGGGAGCCAGAAGAGGG - Intergenic
1114352511 14:21869043-21869065 AAAAAATCAGAGAAAGAAGAGGG - Intergenic
1114532278 14:23403486-23403508 AAGAGAGTAGAGCCAGAAAAAGG + Intronic
1114723759 14:24911400-24911422 AAGAAAGGAAAGGAAGAAGAAGG + Intronic
1114981123 14:28166136-28166158 AACATAGCAAAGCCAGAAGTTGG + Intergenic
1115052559 14:29081260-29081282 AAACTAACAGAGCCAGAAGAAGG + Intergenic
1115395472 14:32903716-32903738 AGGAAAACAAATCCAGAAGATGG - Intergenic
1115975807 14:38995735-38995757 AGGAAAGCAGAGCCAAGAGACGG - Intergenic
1116694475 14:48154887-48154909 AAGAAAGCAGAGCATGTAGGTGG - Intergenic
1116953620 14:50900745-50900767 AAGGCAGCAGAGCCAGGAGGTGG + Intronic
1117197242 14:53352933-53352955 AAGAAAGTACACTCAGAAGAGGG - Intergenic
1117294637 14:54367677-54367699 AGCAAAGGAGAGCCAGAAGATGG + Intergenic
1117308988 14:54503443-54503465 TGGAGAGCAGAGACAGAAGAAGG + Intergenic
1117479316 14:56127543-56127565 AAGCAAGCCAAGGCAGAAGATGG + Intronic
1117764424 14:59065917-59065939 AAGACAGCAGAATTAGAAGAAGG + Intergenic
1118090025 14:62464134-62464156 AAGAAAGGAGAGAGAGAAAATGG - Intergenic
1118136216 14:63031038-63031060 AAGAAAGGAAAAGCAGAAGATGG - Intronic
1118381227 14:65219200-65219222 AAAAAAATAGAGCCAGAAGGAGG - Intergenic
1118621235 14:67616029-67616051 AAGAAAGAAGAGGAAGAAGAGGG + Intergenic
1118781124 14:69008617-69008639 AAGAACTCAAAGCCAGAAAATGG + Intergenic
1118805183 14:69230035-69230057 AAGAAAGGAGGGCCTGATGAAGG - Intronic
1119067402 14:71542628-71542650 AAGAAAGAAGTGGAAGAAGAAGG - Intronic
1119204445 14:72783738-72783760 AAACTAGCAGTGCCAGAAGATGG + Intronic
1119495832 14:75078121-75078143 AAGAAGGCAGAACCAGATGCAGG - Exonic
1119821687 14:77621700-77621722 AAAAAAGAAGAACCACAAGATGG + Intergenic
1119873688 14:78038203-78038225 ATGAGAACACAGCCAGAAGACGG + Intergenic
1119881180 14:78101110-78101132 CAGAAATCAGAGAGAGAAGAAGG - Intergenic
1119942970 14:78660639-78660661 AGAAAATCAGAGCCAAAAGATGG + Intronic
1120061497 14:79988726-79988748 GAGAAAGCTGAGCTTGAAGATGG - Intergenic
1120146070 14:80980011-80980033 AAGCAAGCAGGGCCAGATCACGG - Intronic
1120356703 14:83443464-83443486 AATAAAGCAGAGCCAGTAAAAGG + Intergenic
1120389485 14:83887947-83887969 ATGAAAGCACAGGAAGAAGATGG - Intergenic
1120903144 14:89593155-89593177 AAGAAAGCAGAGAAGGAAGGAGG + Intronic
1120908561 14:89643518-89643540 AAAAGAGCAGAGTCAAAAGAAGG - Intergenic
1121181528 14:91932587-91932609 AAGAAATCAGTGCATGAAGAGGG + Intronic
1121399981 14:93667129-93667151 AAGGAAGGAGAGAGAGAAGAAGG + Intronic
1121797310 14:96745892-96745914 AATAAAGCAGAGCCAGGATGGGG - Intergenic
1123567645 15:21566868-21566890 AAAAAATCAAAGCCAGAACAGGG + Intergenic
1123776739 15:23588093-23588115 CAGAAAGCAGTTCTAGAAGATGG - Intronic
1124156757 15:27232961-27232983 CAGGAAGCACAGCCAGAAGCCGG + Intronic
1124195834 15:27627776-27627798 AAGAAAGGAGAGAGAGAAGAAGG + Intergenic
1124236216 15:27991463-27991485 AAGAAGCCAGACACAGAAGATGG + Intronic
1124244185 15:28055983-28056005 GAGAAAGGAGAGACACAAGAGGG + Intronic
1125089759 15:35776578-35776600 AAGAAGGAAAAGACAGAAGAAGG + Intergenic
1125253942 15:37740841-37740863 AAAAAAGCAGAAGAAGAAGAAGG - Intergenic
1125325514 15:38532568-38532590 TAGAAAGAAGAGGTAGAAGATGG - Intronic
1125993992 15:44138657-44138679 CAGAAAGAAGAGCCCAAAGAAGG + Intronic
1126088564 15:45031593-45031615 AAGAAAGTGAAGCCAAAAGATGG - Intronic
1126165657 15:45651877-45651899 AAGAAAGAAGAAGAAGAAGAAGG - Intronic
1126197160 15:45944899-45944921 AAGAAAGAAGCCCCAGAGGATGG + Intergenic
1126370211 15:47938033-47938055 AAGAAAGGAGGGAAAGAAGAAGG + Intergenic
1126630274 15:50727826-50727848 AACAAATCAGACTCAGAAGAAGG + Intronic
1126650089 15:50911346-50911368 AAGAAAGCAGAAACAGAAATAGG - Intronic
1128094629 15:64944306-64944328 AAGAAATCAGAGCCCAGAGATGG - Intronic
1128445525 15:67756262-67756284 AAGAAAGCAGCATAAGAAGATGG - Intronic
1128487519 15:68109521-68109543 AAGGAAGCAGAACCACAAAATGG - Intronic
1128994025 15:72283521-72283543 AAGGAAGCAGAGCCAAGAGATGG + Intronic
1129016387 15:72473088-72473110 AAGGAAGAAGAGGCATAAGAAGG - Intergenic
1129245947 15:74278718-74278740 AAGGAAGCAGAACCAGAGAAAGG - Intronic
1129386397 15:75198456-75198478 AAGCAAGCAGAGCCTGAAGCTGG - Intronic
1129712160 15:77825937-77825959 AAGAAAGAAGAGCAGGGAGAGGG + Intergenic
1130209265 15:81908311-81908333 AAGGAAGCAGAGAGAGTAGAAGG - Intergenic
1130398248 15:83523744-83523766 AAGAAAGAAGAGAGAGAAGGAGG - Intronic
1130428621 15:83823996-83824018 AAGAAAGAAGAGGAAGAAGAAGG - Intronic
1130697187 15:86142324-86142346 AAGCGAGCAGGGCGAGAAGAGGG - Intronic
1130882710 15:88068925-88068947 AGGAAAGTAGAGCAGGAAGAAGG + Intronic
1131537867 15:93252603-93252625 AGGAAAGCAGAACAAAAAGATGG + Intergenic
1131606188 15:93905200-93905222 AAGATAACAGAGGTAGAAGAGGG - Intergenic
1131823878 15:96300806-96300828 AAGAAAAAAAAGCCAGAACAAGG - Intergenic
1131893263 15:96997508-96997530 ATGAAGGCAGAGACAGAAAAGGG - Intergenic
1132078277 15:98841300-98841322 AAGGAAGCACAGCCAGTAAATGG - Intronic
1132195611 15:99912541-99912563 AAGAAAGAAAAGAAAGAAGAAGG - Intergenic
1133221526 16:4321019-4321041 AAGAAAGCAAGTCCAGAAGCCGG - Intronic
1133747482 16:8698321-8698343 AAAAAAAAAGAGCCAGAAGGGGG - Intronic
1134227744 16:12404457-12404479 AACAAAGCAGTCCCAGAACAAGG - Intronic
1134305825 16:13031190-13031212 AGGAAGGCAGAGGCAGAAGAGGG - Intronic
1134352015 16:13446478-13446500 AATAAAGCAGGGTCAGCAGAGGG + Intergenic
1134517655 16:14900092-14900114 AGGGAAGCAGAGCCAGGAGGTGG - Intronic
1134659083 16:15970224-15970246 AGGACAGCAGAGCAACAAGATGG - Intronic
1134705323 16:16298743-16298765 AGGGAAGCAGAGCCAGGAGGTGG - Intergenic
1134962218 16:18413371-18413393 AGGGAAGCAGAGCCAGGAGGTGG + Intergenic
1134966515 16:18495970-18495992 AGGGAAGCAGAGCCAGGAGGTGG + Intronic
1135057757 16:19244725-19244747 AAGATGGCAGAGCCATGAGATGG - Intronic
1135108327 16:19670386-19670408 AAGAACGCAGAGCTGGAAGAAGG - Intronic
1135394653 16:22122089-22122111 AAGAAAGGATGGCAAGAAGAAGG + Intronic
1135469681 16:22719072-22719094 GAGAAAGCAGGGTCAGGAGATGG - Intergenic
1135806464 16:25547272-25547294 AAGAAAGAAGGGCCAGATGGAGG - Intergenic
1136023207 16:27453176-27453198 AAGAAAGCAGAGCTGAGAGATGG + Intergenic
1136078184 16:27831239-27831261 AAGAAAGCAGAGCCATGAAAAGG + Intronic
1137322745 16:47401841-47401863 AAGGAACCAGAGCAAGAATAGGG - Intronic
1137488160 16:48908980-48909002 AAGAAACCAAGGCCAGAAGGTGG - Intergenic
1137687695 16:50398186-50398208 CAGAAAACAGAGCCAAATGATGG - Intergenic
1137699688 16:50488645-50488667 AAGAAAGCACAGAAAAAAGATGG - Intergenic
1137923751 16:52519520-52519542 AGGACAGAAGAGTCAGAAGAGGG - Intronic
1138387388 16:56644937-56644959 AAAAAAACAGAGGCAGAATAAGG - Intronic
1138706661 16:58922013-58922035 AAGAAAGCAGAACTTGAAGATGG - Intergenic
1139004127 16:62550459-62550481 AAGCAAGCAGGGACAGAAGAAGG - Intergenic
1139055513 16:63178977-63178999 AAAAAAGAAGAGACAGTAGAGGG + Intergenic
1139119724 16:64001273-64001295 AAGAAAACAGGACCAGAAGTAGG + Intergenic
1139504607 16:67392703-67392725 TAAAAGGCAGAGCTAGAAGATGG - Intronic
1139661743 16:68425556-68425578 AAGGAGCCAGAGTCAGAAGAAGG + Intronic
1139736309 16:68991840-68991862 AAGAAAGGAGAGCCTGGAGCCGG + Intronic
1140187200 16:72785819-72785841 AAGAAAAAAAAGCCAAAAGAAGG + Exonic
1140615879 16:76663135-76663157 CAGAAGTCGGAGCCAGAAGATGG + Intergenic
1140777438 16:78263015-78263037 AGGAAAGCAGAGCCAAGGGATGG - Intronic
1140909713 16:79440186-79440208 AAGGAAGAAAAGCCAGAAAAGGG + Intergenic
1140943602 16:79747062-79747084 AAGAAAGAAGAAGAAGAAGAAGG + Intergenic
1141020498 16:80491492-80491514 AGGAAAGCAGACCTAGGAGAAGG - Intergenic
1141281722 16:82635253-82635275 AAGACATCAGAGGCAGATGAAGG + Intronic
1141291512 16:82722297-82722319 AAAAAAGTAGAGCCAAGAGATGG - Intronic
1141740521 16:85888957-85888979 ATGAGATCAGAACCAGAAGAAGG + Intergenic
1141844534 16:86598333-86598355 AAGAAAACAGAGGAAGGAGAGGG - Intergenic
1141864266 16:86739358-86739380 AAGAAAGAAGAGAGAGAGGAAGG - Intergenic
1141976570 16:87520189-87520211 AGGAAAGCAGAGCCGAGAGAAGG - Intergenic
1142028008 16:87824704-87824726 AGGAAAGCAGAGGGAGGAGAAGG - Intergenic
1142362386 16:89633545-89633567 CAGAAAGCAGAGCCCGCAGCTGG + Intronic
1142776823 17:2147035-2147057 AAGAAAGAAAATCCAAAAGAAGG + Intronic
1143019936 17:3912103-3912125 AGGAAAGAAGAGCCAGGAAAGGG + Intronic
1143176381 17:4957593-4957615 AAGAAACCAGCTCCAGGAGAGGG + Intergenic
1143391433 17:6561298-6561320 AAGGAGGAAGAGGCAGAAGAAGG - Intergenic
1143657507 17:8304424-8304446 AGGGAAGCAGAGCCAAGAGAGGG - Intergenic
1143784889 17:9248737-9248759 AAGGGAGCAGAGGCAGAGGAAGG + Intergenic
1143861617 17:9895424-9895446 CAGAAACCAGAACCAGGAGAGGG + Intergenic
1144102354 17:11952980-11953002 AGGGAGGCAGAGCCAGAAAAGGG + Intronic
1144308416 17:13990434-13990456 ATGAAAACAGTGCCAGAAGATGG - Intergenic
1144383702 17:14728709-14728731 AAGAAAGAGGAGCCTGGAGATGG + Intergenic
1144712703 17:17412819-17412841 AAGGAAGCAGAACCAGGAGGGGG + Intergenic
1144836736 17:18160394-18160416 AGGAAAGCAGAGCCAGAAGATGG - Intronic
1146053911 17:29571946-29571968 GAGGAAGCAGAGGAAGAAGAAGG + Exonic
1146548861 17:33762930-33762952 AATAAAACAGAGCAACAAGAAGG - Intronic
1147051990 17:37802177-37802199 CAGAAGGCAGAGCAAGGAGAGGG - Intergenic
1147372452 17:40002441-40002463 AAAAAAGTGGAGCCTGAAGATGG + Intergenic
1147538616 17:41337046-41337068 AAGAAAGGAGAGAGGGAAGAGGG - Intergenic
1147841407 17:43374392-43374414 AGAAAAGCAGAACCAGAAGTGGG - Intergenic
1147896884 17:43757051-43757073 CAGAAAGCAGCCCCAGACGATGG - Intronic
1148166878 17:45490205-45490227 AAGAAAGCTGAGCCAGAAAAGGG + Intronic
1148628413 17:49088106-49088128 AAGAAAGCATAGCCTCAGGATGG + Intergenic
1148682191 17:49480820-49480842 GAAAAAGCAGAGCCAAGAGATGG - Intergenic
1148697570 17:49570366-49570388 AAGAAAGCAGGGCCTGAGCAGGG - Intergenic
1148801484 17:50229346-50229368 AAGATATCAGAGCCAGAGTAGGG - Intergenic
1149785242 17:59429215-59429237 AAGGAAGCAGAGCCAAGAAATGG - Intergenic
1150103275 17:62442594-62442616 AAGGAAGCAGAGTCAGATGGTGG + Intronic
1150398055 17:64836609-64836631 AAGAAAGCTGAGCCAGAAAAGGG + Intergenic
1152438757 17:80292396-80292418 GAGAAAACGAAGCCAGAAGAAGG + Intronic
1152472787 17:80499732-80499754 CAGAAAGCAGTGCCCGAAGCTGG + Intergenic
1153187702 18:2503073-2503095 AAGAAAGAAGAGGAAGAAGAAGG + Intergenic
1153279117 18:3397524-3397546 AAGAAGGCAGGGCCACAAGCTGG + Intergenic
1153428426 18:4990470-4990492 AAGAAGACAGAGGCAGAAAAAGG + Intergenic
1153810730 18:8749594-8749616 AAGAAAGCAGAGCCTGAGCTTGG + Intronic
1153818416 18:8810733-8810755 AAGAATGCAGAAACAAAAGAGGG - Intronic
1154026397 18:10710926-10710948 AAGAAAGGGGAGACAGAATAGGG - Intronic
1154332367 18:13440547-13440569 AAGACTGGAGAGCCAGGAGACGG + Intronic
1154510937 18:15101154-15101176 AAGGAAGAAGAGACAGAAAATGG + Intergenic
1155025232 18:21934926-21934948 CAGGAGGCAGAGCCAGGAGAAGG - Intergenic
1155483728 18:26317723-26317745 ATGAAAACACAGCAAGAAGATGG - Intronic
1156165937 18:34421184-34421206 AAGGAAGGAGAGAAAGAAGAAGG + Intergenic
1156239462 18:35238923-35238945 AAGATGGCAGAGCCAAAAGAAGG + Intergenic
1156507585 18:37608126-37608148 AGCAAATCAGAGCCAGAGGACGG + Intergenic
1156520978 18:37722145-37722167 AAGAGAGCTGAGCCAGTAAAAGG + Intergenic
1156958776 18:42997447-42997469 AAGAAAGAAGAGAGAGAAGAAGG + Intronic
1157337998 18:46755549-46755571 AAGCCAGCAGAGCCGGCAGAAGG + Intronic
1157633178 18:49120973-49120995 AAGAAAACAGAGGCAGAGGCTGG - Intronic
1158040420 18:53086527-53086549 AAGAAAGAAGAAGAAGAAGAAGG - Intronic
1158040421 18:53086556-53086578 AAGAAAGAAGAAGAAGAAGAAGG - Intronic
1158138623 18:54232682-54232704 AGAATAGCAGAGCCAGAAAATGG + Intergenic
1158310949 18:56157701-56157723 GAGAAAGTGGAGCCAAAAGAAGG - Intergenic
1158905981 18:62012295-62012317 AAGAAAGGAGAGCCAGTCTATGG - Intergenic
1159224865 18:65521247-65521269 AAAAAAGCAGACAGAGAAGAAGG + Intergenic
1159423605 18:68254593-68254615 CAGAAAGCGTAGGCAGAAGAAGG + Intergenic
1160338521 18:78065765-78065787 AAGAAATTAGAGCCTGAAGCAGG + Intergenic
1160618690 18:80154113-80154135 AGAAAAACAGAGCCAGAAGGAGG - Intronic
1161359994 19:3843083-3843105 AAGAAAGCAGAGGCTCAAGAAGG + Intronic
1161859513 19:6787479-6787501 AAGAAAGCAGAGTTAAGAGATGG - Intronic
1161905843 19:7155925-7155947 AAGAAAGAAGAAGGAGAAGAAGG + Intronic
1162051713 19:8038084-8038106 AAGATGGCAGAGCCAGAAGACGG + Intronic
1162334093 19:10049571-10049593 AAGAAAGAAGAGAAAGAAGGGGG + Intergenic
1163315126 19:16536171-16536193 AAGCAAGGAGAGTCAGTAGAAGG - Intronic
1163758184 19:19119451-19119473 GAGAAAGGAGAGCAAGAAGGAGG - Intronic
1163779435 19:19238815-19238837 AACAAAACAGGGCCAGGAGATGG + Intronic
1163902544 19:20117459-20117481 TGGGCAGCAGAGCCAGAAGAAGG - Intronic
1164649977 19:29884600-29884622 AAGGCAGAAGAGCCAGAGGATGG + Intergenic
1164660663 19:29963816-29963838 AAGAAACCAGAAGCAGCAGATGG - Intronic
1164727327 19:30474956-30474978 AAGAAAGGAGAGAGAGAGGAAGG - Intronic
1164972903 19:32547736-32547758 AAGAGAGCAGAGCCAGGAGGTGG - Intergenic
1165118354 19:33543185-33543207 AAGAAAACGGAACCAAAAGAGGG - Intergenic
1165123623 19:33579120-33579142 AAGAAGGCAGAGCCTTGAGAGGG - Intergenic
1165733703 19:38162763-38162785 GGGACAGCAGAGCCACAAGAGGG - Intronic
1165916393 19:39263733-39263755 GAGAAAGCAGAGAAAGATGAAGG + Intergenic
1166132266 19:40753058-40753080 AAGAAAGCAAAACCAGCAGCCGG + Intronic
1166398285 19:42458627-42458649 AAGAAAGGAGACCAAGAAGATGG + Intergenic
1166749346 19:45157369-45157391 AATAAAGCAGGGACAGGAGATGG - Intronic
1167844202 19:52147224-52147246 AAGAAAGCAGAGAGAGAACTTGG - Intergenic
1167906049 19:52661677-52661699 GGGAGAGCAGAGCCAGAAGGTGG - Intronic
1167921898 19:52788957-52788979 CGGAGAGCAGAGCCAGAAGGTGG - Intronic
1167932136 19:52874611-52874633 TGGAGAGCAGAGCCAGAAGGTGG - Intronic
1167945060 19:52981518-52981540 TGGAGAGCAGAGCCAGAAGGTGG - Intergenic
1167958445 19:53086889-53086911 AGGAGAGCAGAGCCAGAAGGTGG - Intronic
1168089814 19:54075119-54075141 AAGGAAGCAGAGCCTGATGCTGG + Intronic
1168159442 19:54499599-54499621 ATGAAAGAAGAGTCAGAAGCAGG + Intronic
1168437609 19:56333776-56333798 ATAAAAGCAAAGCCAAAAGATGG + Intronic
1168487537 19:56777181-56777203 AAAACAGCAGAGCCAGAACATGG + Intronic
924991223 2:314793-314815 AGAAACGCAGAGCCAGACGAGGG + Intergenic
925207128 2:2016279-2016301 CAGAACACAGAGCAAGAAGATGG + Intronic
925279311 2:2671590-2671612 AAAAAAGAAAAGCCACAAGAAGG + Intergenic
925660442 2:6196646-6196668 AAGAACTCAGAGCCACAACAGGG + Intergenic
925699866 2:6625565-6625587 AAGATATCACAGGCAGAAGAAGG - Intergenic
926174127 2:10573895-10573917 AAGGAAGCAGAGCACGAGGAAGG - Intronic
926818366 2:16824244-16824266 AAGAAAGGAGAGATAGAAGAAGG - Intergenic
927321071 2:21746353-21746375 CAGAAAGGGGACCCAGAAGAGGG + Intergenic
927612253 2:24552965-24552987 AAGGAATAAAAGCCAGAAGATGG - Intronic
928210788 2:29322167-29322189 AAGAAGGCTGAGACAGAGGAAGG - Intronic
928441551 2:31296359-31296381 GAGAAAGCACAGGCTGAAGAAGG - Intergenic
928800101 2:35079007-35079029 TAGAAAATAGAGCTAGAAGATGG + Intergenic
929080032 2:38113280-38113302 AAGGCAGCAGGGCAAGAAGAGGG - Intergenic
929151665 2:38754188-38754210 ATGAAAGCAGGGCCAGTACAAGG + Intronic
929239384 2:39638330-39638352 AAGCAAACAAAGCAAGAAGAGGG + Intergenic
929313275 2:40450237-40450259 AAGAAGACAAAGCCGGAAGAGGG - Intronic
929585870 2:43113987-43114009 GAGACAGCAGAGCCATAAGGTGG + Intergenic
929864793 2:45708868-45708890 AAGGTGGCAGAGTCAGAAGAGGG + Intronic
931046584 2:58360952-58360974 AAGAAAGCAGAACCAAGAGATGG - Intergenic
931548523 2:63415784-63415806 AAGAAAGAAGAGTGAGAAAAAGG + Intronic
931962945 2:67502081-67502103 AAAGAAGCAGAACCTGAAGACGG + Intergenic
931999880 2:67875380-67875402 AAAAAAGGAGAGACAAAAGAAGG + Intergenic
932015388 2:68021567-68021589 AATAAAGAATACCCAGAAGAAGG - Intergenic
932080022 2:68705575-68705597 AGGAAAGCAGAGTGAAAAGATGG - Intronic
932297616 2:70640177-70640199 ATGAAAGCAGAGGCAGAAATTGG - Intronic
932514617 2:72333266-72333288 TAGAAAGCACAGCCAAAATAAGG - Intronic
932822617 2:74914562-74914584 AGGAAAGAAGAGGCAGAAAAGGG + Intergenic
932865997 2:75343820-75343842 AAGAAAGCAGATTCAAAAGATGG - Intergenic
932924411 2:75955885-75955907 CAGAAAGAAGACCAAGAAGAAGG - Intergenic
932957156 2:76365995-76366017 AAGAAAGGAGAGAGAGAGGAAGG - Intergenic
932979265 2:76644126-76644148 AACAAAACAGACCCTGAAGATGG + Intergenic
933056648 2:77678985-77679007 AAGAAAGTAGAGCAAGAACAAGG - Intergenic
933312195 2:80674910-80674932 AAGAAAGAAAAGTCAAAAGATGG + Intergenic
933608151 2:84405998-84406020 AGAAAAGCAAAGCCAGAAGAGGG - Intergenic
933816228 2:86070774-86070796 CATATAGCAGAGCCAGAAAAGGG + Intronic
933926781 2:87100127-87100149 AAGAAAGTAGAGCAAGAACAAGG - Intergenic
934183651 2:89651188-89651210 TAGAAAGCAGAGCCACAAAGAGG - Intergenic
934475308 2:94589511-94589533 AAAAAAACAGAGCAAGGAGAGGG - Intronic
934789217 2:97044207-97044229 CAGAAAGCATCGCCAGAAGACGG + Intergenic
934817262 2:97338334-97338356 CAGAAAGCATCGCCAGAAGACGG - Intergenic
934820434 2:97370150-97370172 CAGAAAGCATCGCCAGAAGACGG + Intergenic
934980517 2:98836049-98836071 GAGAAAGCAAAGCCAGAATATGG + Intronic
935887537 2:107638413-107638435 TAGAAAGCAGAGCCTCAAGATGG - Intergenic
936246227 2:110829900-110829922 AAGAAAGCAGTGAAAGAACAAGG - Intronic
936342162 2:111643266-111643288 GCGGAAGCACAGCCAGAAGAGGG + Intergenic
936866290 2:117078866-117078888 AAGAAGGGACAGCCAGGAGATGG - Intergenic
937017737 2:118620987-118621009 ATGAAGGCACAGCCAGAAAAAGG - Intergenic
937151381 2:119688751-119688773 AAGAATGCAGGGCCAGAAGCAGG - Intergenic
937204163 2:120225014-120225036 AGGAAAGCAGAGCCCGTGGAGGG + Intergenic
937639271 2:124193039-124193061 ACGAAAACAGAGCCAGAAATTGG - Intronic
937759096 2:125578301-125578323 AGGAAAGCAGAGACAGATAAAGG - Intergenic
937971017 2:127549601-127549623 AAGAATGCAGGGGCAGAAGCAGG + Intronic
937998722 2:127715060-127715082 AAGAAAGAAAAGAAAGAAGAGGG - Intronic
938506149 2:131885616-131885638 AAGGAAGAAGAGACAGAAAATGG + Intergenic
938919345 2:135980038-135980060 AAGGAAACAGAGCCAAAAGCTGG + Intronic
939048222 2:137275159-137275181 GAGAAAGAAAAGCCAGTAGAAGG + Intronic
939444175 2:142287630-142287652 AAGAAAGCATGGCCAGGACAGGG + Intergenic
939773002 2:146347489-146347511 AAAAGAGCAGAGCCAGAGGCTGG + Intergenic
940237031 2:151522850-151522872 AAGACAGCAAAGTCAGAACAGGG + Intronic
940575121 2:155493720-155493742 AAGAAAGGAGAGAGAGAGGAAGG - Intergenic
941295592 2:163735484-163735506 AAGAAAGCGGAGCCATAGGGTGG - Intronic
941356483 2:164499565-164499587 AAGAAGGAAGAGCTAGAAAAGGG - Intronic
941733436 2:168945560-168945582 AAGGAAGGAGGGACAGAAGAAGG + Intronic
941740938 2:169034505-169034527 TACAAAGCTGAGCCACAAGAAGG + Intergenic
941962535 2:171268242-171268264 GAGAAGGAAGAGCCAGAAAAGGG - Intergenic
942244437 2:173994067-173994089 TAGAAAGAACAGCCAGAAGCTGG + Intergenic
942377476 2:175352455-175352477 AAGAAAGAGGAGCCAGAAATGGG - Intergenic
942778857 2:179616898-179616920 AAGAAATAAGAGGCAGATGAGGG - Intronic
943979584 2:194531155-194531177 ATGAAAGCAGAGCCAGACAAGGG + Intergenic
943997887 2:194795433-194795455 GAGAAAGCAGAGACAGAATTAGG - Intergenic
944450219 2:199834794-199834816 AAGAGAGTAGAGAAAGAAGAAGG - Intronic
944882256 2:204025744-204025766 AAAAGAGAAGAGACAGAAGAGGG - Intergenic
945585782 2:211660747-211660769 AGAAAAGCAGAGGCTGAAGATGG + Intronic
945806900 2:214501291-214501313 AAGAAACCTGAGCCATAGGAAGG + Intronic
946039608 2:216772519-216772541 AAGAAAGAAGTGCCAGGGGAAGG - Intergenic
946077684 2:217088677-217088699 AAGAAAAGAGAAGCAGAAGAAGG - Intergenic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
946320372 2:218950588-218950610 AGGAAAGCAGAGTCAACAGATGG - Intergenic
946426737 2:219602509-219602531 CAGAAAGCAGAGCCAGCCAAGGG - Exonic
946833670 2:223750276-223750298 GAGAAGGCAGAGCCATGAGATGG - Intergenic
946970514 2:225085925-225085947 AAGAAGGAAGAGGAAGAAGAGGG - Intergenic
947370213 2:229438129-229438151 AATGAAGCAAAGACAGAAGAAGG + Intronic
947497254 2:230646890-230646912 GAGGAAGCAGAGCTAGAAGCCGG - Intergenic
947663313 2:231886299-231886321 AAGATAGCAGAGCCACAAGATGG - Intergenic
947922047 2:233885539-233885561 GAGAAAGCAGAAGCAGAAAAAGG - Intergenic
948316670 2:237032422-237032444 AAGGAAGCAGAGCAAGGAGAAGG - Intergenic
948712395 2:239833293-239833315 AGGTAAGCACACCCAGAAGAGGG + Intergenic
1169542752 20:6618309-6618331 AAGATGGCAGAGCTACAAGATGG - Intergenic
1169749405 20:8976313-8976335 AAGTCAGCAGTCCCAGAAGAGGG + Intergenic
1170179501 20:13513426-13513448 CAGAAGGCAGAGCAAGAAGTGGG + Intronic
1170249235 20:14261986-14262008 AAGAAAGCAAAGCTAAAAGCTGG + Intronic
1170689232 20:18597808-18597830 CAGAAAGAAGAGCCCAAAGAAGG - Intronic
1170704291 20:18731072-18731094 AAGAAAGGAGATCCATAACAAGG - Intronic
1170926735 20:20731475-20731497 AGTAAAGCAGAGCCAGAAAAGGG - Intergenic
1171127110 20:22611938-22611960 ACCAATGCAGAGACAGAAGATGG - Intergenic
1171247388 20:23622845-23622867 AAGAAAGGAGAGGGAGCAGATGG - Intergenic
1171790600 20:29519918-29519940 AAGAAAGAAGAGGAAGAAAATGG - Intergenic
1171857107 20:30356917-30356939 AAGAAAGAAGAGGAAGAAAATGG + Intergenic
1172056883 20:32160217-32160239 AAGAGCTCAGAGCCAGAAGCAGG - Intronic
1172487837 20:35309558-35309580 AAGAAAGCAGAACTGGAAGAAGG + Intronic
1172924287 20:38517086-38517108 AAGAATGGAGAGCCACCAGATGG - Intronic
1173140352 20:40476425-40476447 AAGAGAACAAAGCCTGAAGAGGG + Intergenic
1173439602 20:43064292-43064314 AGGAAGACAGAGCCACAAGATGG + Intronic
1173605515 20:44328192-44328214 AAGATGGCAGAGCAAGGAGAGGG - Intergenic
1174050847 20:47766331-47766353 AGGCAAGGAGAGCCACAAGATGG - Intronic
1174085226 20:48003255-48003277 AGGAAAGTAGAGGCATAAGAAGG - Intergenic
1174589450 20:51633800-51633822 AAGAAAGAAAGGACAGAAGAAGG + Intronic
1174769034 20:53281158-53281180 AAGAATGCTGAGCCAAAAAATGG + Intronic
1175055169 20:56191301-56191323 AAAAAGGCAGAGCCAGCAGGAGG + Intergenic
1175477142 20:59284766-59284788 GAGAAAGAAGATCCAGAAAAGGG - Intergenic
1176311161 21:5150424-5150446 ATGAAAGCAGAGCCTGAAATGGG - Intronic
1176786919 21:13268116-13268138 AAGGAAGAAGAGACAGAAAATGG - Intergenic
1177216808 21:18140627-18140649 AAAAAAATAGAGCCAGAAAATGG + Intronic
1177628339 21:23694579-23694601 AATAAAACATAGACAGAAGATGG - Intergenic
1177732037 21:25039943-25039965 ATGAGAACAGAGACAGAAGATGG - Intergenic
1177757634 21:25367047-25367069 GAGACAGCAGAGTCAGAAGGTGG - Intergenic
1177986082 21:27976762-27976784 AAGGAAGAAGAGACAGAAAATGG - Intergenic
1178421947 21:32450349-32450371 AGAGAAGCAGAGCCACAAGATGG - Intronic
1178446415 21:32647607-32647629 AAGAAAGCAGAATCAGATGGAGG - Intronic
1178572852 21:33756757-33756779 AAAAAAGCAGAGCCTGCATAAGG - Intronic
1178634913 21:34293857-34293879 AAGAAAGTAGTTCCAGAAGAAGG - Intergenic
1178725177 21:35045038-35045060 AAGAAAGCAGAGCCAAGAGGAGG + Intronic
1179219904 21:39396797-39396819 AAGACAGCAGAGACAGATGGGGG + Intronic
1179302668 21:40126359-40126381 AAGAAAGGAAAGAAAGAAGAAGG + Intronic
1179845889 21:44111611-44111633 ATGAAAGCAGAGCCTGAAATGGG + Intronic
1180719393 22:17896139-17896161 AAGAAGGCAGAGAAAGAAGAAGG + Intronic
1180929180 22:19577312-19577334 AAGCAAGCAGAGAGAGAGGAGGG - Intergenic
1181296409 22:21843342-21843364 AAGACATCAGAGGCAGAAGAAGG + Intronic
1181455631 22:23058771-23058793 ATGAAGGCACAGGCAGAAGAGGG + Intergenic
1181616127 22:24055508-24055530 AAGAGAGCAGGACCAGAAGAGGG - Intronic
1181809264 22:25393433-25393455 AAGGAAGCAGACGCAGCAGACGG + Intronic
1181810339 22:25400246-25400268 AAAAAAGCAGAGCCGGATGCTGG - Intronic
1181998577 22:26902593-26902615 AAGGAAGGAGAGCGAGAGGAAGG - Intergenic
1182533225 22:30978708-30978730 GGGAAAGCAGAGCCAAAATATGG + Intergenic
1182827298 22:33276957-33276979 AAGAAAGCAGAGAGCTAAGAGGG - Intronic
1182886305 22:33777071-33777093 AAATGAGCTGAGCCAGAAGATGG + Intronic
1182901820 22:33904589-33904611 AAGAAGGCAGAGCCAGGCGTGGG + Intronic
1182922309 22:34091266-34091288 AGGAAAACAGAACCAAAAGATGG + Intergenic
1183004688 22:34891301-34891323 AGGAAAGCAGAGTTAGAAGTGGG - Intergenic
1183772129 22:39935923-39935945 GCGAAAACAGAGCAAGAAGATGG + Intronic
1184076471 22:42182215-42182237 AAGAAGGCAGAGCTAGAAAGTGG - Intronic
1184145132 22:42605670-42605692 GAGAAAGCAGGGCCAAAGGAAGG + Intronic
1184509341 22:44924034-44924056 AAGAAAGAGGAGGAAGAAGAGGG + Intronic
1184772210 22:46604108-46604130 CAGAAAACAGAGCCACGAGAAGG - Intronic
1185412497 22:50692105-50692127 AAGAAAGAAAAGCTAGCAGAAGG - Intergenic
949373240 3:3358066-3358088 AAGGGAGCAGAGCCAGGAGATGG + Intergenic
949422215 3:3878169-3878191 AACAGAGGAGAGCCAAAAGAGGG - Intronic
949996906 3:9625110-9625132 CAGAAAGTGGAGACAGAAGAGGG - Intergenic
950019684 3:9778543-9778565 AGAAAAGCAGAGCCAGGAGATGG - Intronic
950339903 3:12233994-12234016 GAGAATGAAGAACCAGAAGAAGG - Intergenic
951050564 3:18088850-18088872 AAGAAAGGAGAGCCAGCAAATGG + Intronic
951051958 3:18103826-18103848 AAGAAAGCATAGAAAGAAAAAGG - Intronic
951057402 3:18163492-18163514 CAGAAAACAGAGCCAAAATAAGG - Intronic
951081328 3:18453625-18453647 AAGAAAGCATAACCAAAAGATGG - Intergenic
951835698 3:26981037-26981059 AAGATGGCAGAGCCACAGGATGG + Intergenic
952171359 3:30810731-30810753 AAGAAAGGCGAGCCAGAGGAGGG - Intronic
952438733 3:33300690-33300712 AAGAAAGCATAGCTAGGAAAAGG - Intronic
952830051 3:37557179-37557201 AAGAAAGCAGACCCAAGAAAAGG - Intronic
952991052 3:38831145-38831167 AAGATGGCAGAGTCAAAAGATGG - Intergenic
953039420 3:39241874-39241896 ACAAAAGCAGAACCAAAAGATGG - Intergenic
953361752 3:42303284-42303306 AAGATAGCAGAGGCAGAGGCAGG + Intergenic
953402771 3:42640779-42640801 GAGAAAGGAGAGCTAGCAGAGGG - Intronic
953557318 3:43956822-43956844 AAGAAAGCAGAGCCTGAGATGGG + Intergenic
953610088 3:44440343-44440365 AAGAAATGGGATCCAGAAGATGG - Exonic
953682786 3:45052108-45052130 GAGAAAGAAGAGCCTGGAGAAGG - Intergenic
953915338 3:46916236-46916258 AAGAAAGCAGAGAGAAAAGGTGG - Intergenic
954516100 3:51178557-51178579 GAGAAAGCAGAGCCAGAGCTGGG + Intronic
954770137 3:52959651-52959673 AGGGAAGCAGAGCCTAAAGATGG - Intronic
954985985 3:54792548-54792570 AGGAAAACAGAGCCAAGAGATGG - Intronic
955220698 3:57020682-57020704 AAGAAAGCAGAGCCAAGAGAAGG + Intronic
955360289 3:58268347-58268369 AAAAAAGCAGACGTAGAAGAGGG - Intronic
955824409 3:62930066-62930088 AGGAAAGAAGAGCCACAAAATGG + Intergenic
956030087 3:65028163-65028185 AAGAAATCAGAGCCAGCCAAAGG + Intergenic
956380950 3:68663871-68663893 AAGAAAGCAGAGGTAAGAGATGG + Intergenic
956642475 3:71428059-71428081 ATGATAGCAGTGCCTGAAGATGG - Intronic
956713061 3:72055369-72055391 AAGAAAACAAAGCAGGAAGAGGG + Intergenic
956814669 3:72897301-72897323 AAGGAAGCAGAGCTAAAAGGAGG - Intronic
957196684 3:77077855-77077877 GAGAAAGCAGAGACAGAAACTGG - Intronic
958644335 3:96850287-96850309 AGGAGAGCAGAGTCAGAAGCTGG + Intronic
958702165 3:97606370-97606392 GAGAAAGCAAAGGCAGAATATGG + Intronic
958704628 3:97640151-97640173 CAAAAAGCAGAGGCTGAAGAAGG + Intronic
959222122 3:103533350-103533372 AAAAAAACAGAGGAAGAAGAAGG + Intergenic
959445730 3:106436352-106436374 AAGAAAGAAGAGAGAGAAGGAGG + Intergenic
959603267 3:108212956-108212978 AAGGAAGAAGAGCAAGAGGAAGG - Intronic
959733282 3:109628573-109628595 AAGGAAGCCCAGGCAGAAGATGG - Intergenic
960374419 3:116880901-116880923 AAGAAAACAAAGGTAGAAGAAGG - Intronic
960988636 3:123296289-123296311 AAGAAAACAGGGCCAGCAGTGGG - Intronic
961162249 3:124738400-124738422 AAGAAAGCAGAGCTGAGAGATGG - Intronic
961433466 3:126899815-126899837 AAGAAGGCAGAGCCAGGAGATGG + Intronic
961879405 3:130050277-130050299 AAGAAAGAAGAAGGAGAAGAAGG + Intergenic
962332348 3:134489047-134489069 AAGGAAGCTGAGGCAGGAGAAGG + Intronic
962378254 3:134876496-134876518 AAGAGAGCAGAGCCAAGGGAGGG - Intronic
962452102 3:135528498-135528520 AAGAAAGCTGAGCCTGAACATGG - Intergenic
962804680 3:138918205-138918227 AAGAAAGAAGAAGAAGAAGAGGG - Intergenic
962992190 3:140588137-140588159 AAGATGGCAGAGCCAGGAGATGG + Intergenic
963559912 3:146851351-146851373 AAAAAAGAAGAGGAAGAAGAAGG + Intergenic
963637884 3:147822616-147822638 AAGAAAGCATAGCAAGGAGATGG - Intergenic
963729235 3:148955646-148955668 AAAGAAGCCGAACCAGAAGAGGG + Intergenic
963906540 3:150778299-150778321 AAGAAACCAGACCCATCAGAAGG + Intergenic
964159308 3:153627485-153627507 CAGAAAGCAGAGCCACTAAAGGG + Intergenic
964326781 3:155555433-155555455 AAGATGGCACAGCCACAAGATGG + Intronic
964344047 3:155738295-155738317 AAGAAAGAAGACCCAGAAGAAGG + Intronic
964434262 3:156635486-156635508 ACAAAGGCAGAGCCAGAGGAAGG - Intergenic
964463127 3:156958967-156958989 AAGAAAGCAGATTAAGAAGATGG - Intronic
964574278 3:158147067-158147089 AAGAAAGAAAAGGAAGAAGATGG - Intronic
965327916 3:167330787-167330809 AAGAAAGAAGAAGAAGAAGAAGG + Intronic
965383933 3:168023495-168023517 AAGAAAGCAGACCTAGTCGAGGG + Intronic
965678401 3:171224143-171224165 ACGAAAGCAGAGCCCACAGATGG + Intronic
966183141 3:177204777-177204799 AAGAAAGGAGTGGCAGGAGACGG + Intergenic
966199024 3:177342371-177342393 AGGAAGGCAGAGCTATAAGACGG + Intergenic
966342981 3:178945918-178945940 AAGATAGCAGAGCCATCAGATGG - Intergenic
966457258 3:180131676-180131698 AAGAAAGCAGAGAGAAAAGTGGG + Intergenic
966976554 3:185088966-185088988 AAGCCAGCAGAGCCTGAAGAGGG + Intronic
967300496 3:188007944-188007966 AATAAAGCAGACCAAGAAGAGGG + Intergenic
967307770 3:188075701-188075723 AAGGAAGAAGAGCTAAAAGATGG + Intergenic
967417653 3:189236757-189236779 AAGAAAGGAGAAGCAGAAAAAGG - Intronic
967490468 3:190085185-190085207 AATAAATCAGAGAAAGAAGAAGG + Intronic
967518881 3:190404719-190404741 GTTAAAGCAGAGTCAGAAGAAGG - Intronic
967556219 3:190862384-190862406 GAGAAAGGAGAGAAAGAAGAGGG + Intronic
967567704 3:190991289-190991311 CAGAAAGCAGTTACAGAAGATGG - Intergenic
967610995 3:191506034-191506056 ACCAAAGAAGAGACAGAAGAAGG - Intergenic
968323921 3:197795535-197795557 TGGGAAGCAGAGCCAAAAGATGG + Intronic
968944228 4:3655140-3655162 AAGACACCAGAGCCAGCAGAAGG - Intergenic
969823718 4:9740267-9740289 AAGAAAGCAGAAGGAGAAGAAGG - Intergenic
970076659 4:12229612-12229634 ATGAAGACACAGCCAGAAGATGG + Intergenic
971003016 4:22343412-22343434 GAGAAAGCAGAGACATAGGAAGG + Intergenic
971132297 4:23826187-23826209 AGGAAATGAGAGCCATAAGAAGG + Intronic
971497588 4:27283656-27283678 AAGATGGCAGAGCCACAAGATGG + Intergenic
971600561 4:28586208-28586230 AAAAAAGGAGAGGAAGAAGAAGG - Intergenic
971803257 4:31319675-31319697 AGAAAGGCAGAGCCACAAGAAGG - Intergenic
971906553 4:32733138-32733160 AAGGAAGCAGAGCTAGAAGGAGG + Intergenic
972112937 4:35588181-35588203 AAGAAAGGAATGGCAGAAGATGG + Intergenic
972384044 4:38546480-38546502 AAGACACCACACCCAGAAGAGGG + Intergenic
972523289 4:39883086-39883108 AAGGAAGCAGAGCAAGAAGAAGG - Intronic
972701959 4:41503045-41503067 AAGAAAGCAGAGGCAAGAGATGG - Intronic
973015984 4:45137780-45137802 AAGACAGCAGAGCCATCAAATGG + Intergenic
973030570 4:45332272-45332294 AGGAAAGCAGAGACAGAGGAGGG - Intergenic
973066090 4:45795204-45795226 AAGAAAGAAGAGCAAAAGGAAGG - Intergenic
973563342 4:52159082-52159104 AAGAAAGGAGGGAGAGAAGAAGG - Intergenic
973828841 4:54737711-54737733 AAACAAGCATAGCCAGAAAATGG + Intronic
973870467 4:55161021-55161043 AGGAAAAAAGAGCCAGGAGATGG - Intergenic
974351469 4:60752921-60752943 AAGAAACCAGAACCAGAAACAGG - Intergenic
976367888 4:84250456-84250478 AACAAAACAGAACCAGAAGTGGG + Intergenic
976447329 4:85146256-85146278 CAGACAGCAGAGCCACAAGATGG - Intergenic
976775505 4:88701699-88701721 AAGAAAGAAGGGCGGGAAGAGGG - Intronic
977610115 4:99022270-99022292 AACAGAGCAGGGCCAGGAGATGG + Intronic
977660422 4:99579167-99579189 AATCAAGAAGAGCCAGGAGAAGG - Intronic
977842427 4:101724848-101724870 AAGAAAGCAGAGACAAAATTAGG + Intronic
978385063 4:108169872-108169894 AGGAGAGCAAAGCCAGAAGAGGG + Intergenic
979340193 4:119513427-119513449 AAGAAAGGAAAGGCAGTAGAGGG - Intronic
979781519 4:124656926-124656948 AACAAAGCAAAGCAAGCAGAAGG + Intergenic
980407791 4:132376024-132376046 AAGAAAGTAAAGCCAGGAAATGG + Intergenic
980736308 4:136894018-136894040 AAGTTAGTAGAGACAGAAGAAGG + Intergenic
980761875 4:137245161-137245183 AAGAAAGCAGCTTGAGAAGATGG - Intergenic
981363412 4:143873480-143873502 AAGAGAGAAGAGCCATGAGAAGG + Intronic
981374150 4:143994281-143994303 AAGAGAGAAGAGCCATGAGAAGG + Intergenic
981786377 4:148483792-148483814 GAGACAGCAGAGCCACAAGGTGG - Intergenic
981823635 4:148914668-148914690 AAGAAACCTGAGCCAAATGACGG + Intergenic
982194783 4:152900032-152900054 CAGATAGCAGAGAGAGAAGATGG + Intronic
982410573 4:155071881-155071903 AAGAAAGTAGAGAAAGAGGAAGG + Intergenic
983113244 4:163780202-163780224 TAGAATGCAGAGCCCCAAGAAGG + Intronic
983168012 4:164501060-164501082 AAGAAAACAGAACAAGAAAATGG - Intergenic
983549013 4:168995391-168995413 AAAAAAGCAGATCTAGAATAAGG + Intronic
983554318 4:169046362-169046384 AGGAAAGCAGATCCACAAAAGGG + Intergenic
983982032 4:174009554-174009576 AAGAAATCATAGCCAGAGGGTGG + Intergenic
984451114 4:179903889-179903911 AAGAAACCAGAGACAAAAGACGG - Intergenic
984846199 4:184110055-184110077 ATGGAAGCAGAGCCAGGGGAAGG + Intronic
985334487 4:188877170-188877192 AACACAGCAGAGACATAAGAAGG - Intergenic
985486350 5:153620-153642 AAGAAAGAAGAAACAGAGGACGG - Intronic
985646975 5:1089523-1089545 ATGGAAGCAGAGCCAGCGGAGGG + Intronic
985860775 5:2469032-2469054 AAGGAAGGAGAGCCTGGAGATGG + Intergenic
986078787 5:4367056-4367078 AAGAGAACACAGCCAGAATAAGG + Intergenic
987065836 5:14288748-14288770 AAGGCAGCAGAGGTAGAAGAGGG - Intronic
987353705 5:17043944-17043966 TAGAAAAGAGAGGCAGAAGAGGG - Intergenic
987508831 5:18808892-18808914 GAGGAAGCAGAGATAGAAGAAGG - Intergenic
987574131 5:19704016-19704038 TGGAAAGCAGAGCCAGGAGAGGG + Intronic
987630398 5:20462771-20462793 AAGAAATCTGAGATAGAAGAAGG + Intronic
987675948 5:21072910-21072932 AAGGAAGAAGAGGAAGAAGAAGG - Intergenic
987942350 5:24556119-24556141 AAGAAAGCTGAGATAGAAGTGGG - Intronic
988038418 5:25857895-25857917 ATGAATGGAGAGCCAGAAGAGGG - Intergenic
988464947 5:31480853-31480875 AAGAAAGGAGAGAAGGAAGATGG + Intronic
988632090 5:32942425-32942447 AAGAAAGAAGAAGGAGAAGAAGG + Intergenic
988912003 5:35852587-35852609 ATGAAAGAAGAGCCACAACAAGG + Intergenic
989179256 5:38559837-38559859 CAGAAAGAAGAGCCAGTAGCTGG - Intronic
989374594 5:40747710-40747732 AAGAAAGAAGAGAAAGAACAAGG + Intronic
989971024 5:50524332-50524354 AAGAATGTAGAACCTGAAGAAGG + Intergenic
990123427 5:52484351-52484373 AGGAAAGAAGAGAAAGAAGAAGG + Intergenic
990379508 5:55208077-55208099 AAGAAAGGAGAAAGAGAAGAAGG + Intergenic
990468564 5:56092044-56092066 AAGAAAGGAGAGTTAGCAGAAGG + Intergenic
990636902 5:57738379-57738401 GAGAAAGCAAAGCAAGGAGAAGG - Intergenic
990742590 5:58927462-58927484 AAGAAAGAAGAGGAAGAAGCTGG - Intergenic
990880460 5:60532119-60532141 GAGAAAACAGAGCCAGAGGTAGG + Intergenic
991070179 5:62469204-62469226 GAGAAAGCATATCCAGAATAAGG + Intronic
991080107 5:62589372-62589394 AAGAGAGCAAAGACATAAGAAGG - Intronic
991184231 5:63788565-63788587 AAGAAAAGAGAGACACAAGAGGG + Intergenic
991468604 5:66942955-66942977 AAGAAGACATAGCAAGAAGATGG - Intronic
991507346 5:67339170-67339192 AAGAAAGGAGAGAGAGAGGAAGG - Intergenic
991632498 5:68670410-68670432 AAGAAAGGAGAGCCTGATGTGGG + Intergenic
992810906 5:80387616-80387638 AAGAAAGAAGAGCCAACAGTTGG - Intergenic
992836531 5:80647318-80647340 AAGAAAGAACAGCATGAAGATGG + Intronic
993150421 5:84154677-84154699 AAAAAAGCAGAAGCAGAAGAGGG - Intronic
993502474 5:88678835-88678857 AGGAAAGAAGAGACAGAAAAAGG + Intergenic
993954562 5:94216236-94216258 AAGAAAGCAGGGTAAGAATATGG + Intronic
993962614 5:94318866-94318888 AAAAGAGGAGAGCCTGAAGACGG + Intronic
993998962 5:94755292-94755314 AGGAATCCAGAGCTAGAAGAGGG - Intronic
994180038 5:96754114-96754136 AAGGAAGCAGATCCAGAAGATGG + Exonic
994279103 5:97878674-97878696 AAGAAAATAGAGACAGAAGAAGG - Intergenic
994592476 5:101790019-101790041 AACAAACTAGAGCCAGAAGGGGG + Intergenic
994716372 5:103326735-103326757 CGGAAAGCATAGGCAGAAGAAGG + Intergenic
994744829 5:103665370-103665392 AAGATACCAGAGCGGGAAGATGG - Intergenic
994926276 5:106120953-106120975 AAGAGAGCAGAGCCAGAAGGCGG - Intergenic
995566955 5:113440755-113440777 AAGAAAGAAGAGGAGGAAGAAGG + Intronic
996105440 5:119496698-119496720 AAGAAAGCAGGGAGGGAAGAAGG - Intronic
996188168 5:120505113-120505135 AAGAAAGCAGAAGGAAAAGAGGG - Intronic
996297232 5:121935482-121935504 CAGTAGGCAGAGGCAGAAGAAGG - Intergenic
996375237 5:122798701-122798723 CAAAAAGCAGAGCCAGGAAAGGG - Intronic
996593254 5:125172331-125172353 AAGAAAGAAGAGCCAAAAATAGG + Intergenic
996776526 5:127138218-127138240 AAGAAAACAGAGGGAAAAGAAGG + Intergenic
996809172 5:127494983-127495005 AAGAAAGAAGAGAAAGAGGAAGG + Intergenic
997428758 5:133823161-133823183 AAGAAAGCAGAGCCCAGAGCTGG + Intergenic
998166174 5:139845473-139845495 ACGAAACCAGAGACAGCAGAGGG + Intergenic
998407426 5:141882076-141882098 AGGCAAGAAGGGCCAGAAGAGGG - Intergenic
998543408 5:143004783-143004805 AAGTGAGCAGAGCCAGAGGGTGG + Intronic
998660688 5:144233856-144233878 AAGGAAGGAGAGGGAGAAGAGGG + Intronic
998717353 5:144900286-144900308 AGGAAAGTAGAGCCAAAATATGG - Intergenic
998817894 5:146032061-146032083 AAGGAAGCAGAGATAGATGATGG - Intronic
998869367 5:146537126-146537148 GAGAAAGCAGAGGCAGCAGAAGG + Intergenic
999007590 5:147999875-147999897 AAGATAGAAGGGCCAGAAAAAGG + Intergenic
999090585 5:148932442-148932464 AAGAAACAAGGGACAGAAGAAGG - Intronic
999246405 5:150157316-150157338 AGGAAAGGAGAGCCAGAGAATGG - Intergenic
999328387 5:150657111-150657133 GGGAGGGCAGAGCCAGAAGAAGG + Intronic
1000093853 5:157953576-157953598 AAGATCGAAGAGCGAGAAGAAGG - Intergenic
1000128448 5:158270723-158270745 AAGAAAACAGAGGCAGAGCATGG + Intergenic
1000209798 5:159098580-159098602 AAGAAAGAAGAGAAAGAAAATGG + Intronic
1000436013 5:161209410-161209432 AAGAAAGGAGAGAGAGAAGAAGG + Intergenic
1000458766 5:161485932-161485954 AGGAAAGTACAGCCAAAAGATGG + Intronic
1000781246 5:165484773-165484795 AGGAAAGCAGAGGCAGGAGCTGG - Intergenic
1001405339 5:171472866-171472888 AAGAGAGCTGAACAAGAAGAAGG + Intergenic
1001694299 5:173658716-173658738 AGGAATGCAGAGCCACAAGATGG - Intergenic
1001787287 5:174424622-174424644 AAGACAGCAGGGCCAGTAGTTGG + Intergenic
1001819290 5:174697088-174697110 AAGGCAGCAGAGACAGAAGTGGG - Intergenic
1002085621 5:176773546-176773568 AAGAAAGTAGAGCCTTCAGAGGG + Intergenic
1002108681 5:176893385-176893407 AGGACTGCAGAGCCAGAAAAAGG - Intronic
1003571685 6:7260416-7260438 AAGAAAGCAGAACCAGGAGATGG - Intergenic
1003874721 6:10425564-10425586 AGGAAAGAAAAGACAGAAGACGG - Intergenic
1004048703 6:12051439-12051461 GAGAAGGCAGAGATAGAAGATGG - Intronic
1004129002 6:12901399-12901421 AAGAAAGCAGAGAGAAAGGAGGG + Intronic
1004748406 6:18536145-18536167 GAGAAAACAGAGCCAGAAGGAGG - Intergenic
1005220967 6:23588077-23588099 AAGGAAGCTAAGCCAGAAGCTGG - Intergenic
1005816818 6:29559719-29559741 CAGAAACCAGAGACAGAAAAAGG + Exonic
1006151541 6:31992677-31992699 AAGGATACAGAGCCAGGAGATGG - Intronic
1006157842 6:32025415-32025437 AAGGATACAGAGCCAGGAGATGG - Intronic
1006909861 6:37556931-37556953 AAGGGGGCAGAGCCAGAGGAGGG + Intergenic
1006984991 6:38170090-38170112 AAGCAGCCAGAGCCAGATGAAGG + Exonic
1007126380 6:39429225-39429247 AAGAAGGTAGACCCGGAAGAAGG - Intronic
1007186734 6:39978119-39978141 AACAAAGCAGAGTAATAAGAGGG - Intergenic
1007259174 6:40550577-40550599 AAGCATGCACTGCCAGAAGAAGG + Intronic
1007978444 6:46125721-46125743 AAGAAAGCAAAGCCAAGAGCTGG - Intergenic
1008122033 6:47629825-47629847 AAGACAGCAAGGCCAGATGATGG + Intergenic
1008453065 6:51675286-51675308 AAGAAAACAAATCCAGAGGAAGG - Intronic
1009062761 6:58417420-58417442 TGGAAAACAGAGCCAGAAGAGGG - Intergenic
1009923586 6:70093423-70093445 TAGAAAACAGAGCCAGAAGTTGG + Intronic
1009977280 6:70684909-70684931 AAGAAATCAGAGTCAGCAGTGGG - Intronic
1011358635 6:86498633-86498655 AGAAAGGCAGAGCTAGAAGATGG + Intergenic
1011553325 6:88549406-88549428 AAGAAAGAAGCAGCAGAAGAAGG - Intergenic
1011793682 6:90928654-90928676 AAGAAAGCAGCACCTGCAGAAGG - Intergenic
1011824871 6:91293995-91294017 AGGAAAAAAGAGACAGAAGAGGG + Intergenic
1011830608 6:91366692-91366714 GAGAAAGAAGATCTAGAAGATGG + Intergenic
1011847671 6:91586628-91586650 AAGAAACCAGACTAAGAAGATGG - Intergenic
1012639716 6:101594471-101594493 AAGAAAGCACAACCATAAAATGG + Intronic
1012930489 6:105311156-105311178 AAGGAAGCAGAGAGAGCAGATGG - Intronic
1013569919 6:111411974-111411996 AAAAAATGGGAGCCAGAAGAAGG - Intronic
1013653800 6:112224456-112224478 ATGGAAGCAGAGCCAGACGATGG - Intronic
1013752599 6:113424472-113424494 AACATAGCAGAGCGGGAAGATGG - Intergenic
1014443989 6:121505348-121505370 AGGAAAGGAGAGGGAGAAGAAGG - Intergenic
1014571830 6:123019007-123019029 AAGACAGCAGCGCAAGAAGGTGG - Intronic
1014714800 6:124850804-124850826 AAGAAAGCAGAATCAGGTGATGG - Intergenic
1014743464 6:125172048-125172070 AAGAAAGAAGAGAAAGAAGGTGG - Intronic
1015285500 6:131482152-131482174 AAGAAAGAAAAGAAAGAAGAAGG - Intergenic
1015938692 6:138427823-138427845 AAAAAAGCACAGACAGTAGATGG + Intronic
1016360954 6:143266957-143266979 ATTTAAGCAGAGCCAAAAGAAGG + Intronic
1016863373 6:148743843-148743865 AAGAAAGCAGAGGGTGGAGATGG + Intergenic
1016902233 6:149114002-149114024 AAGAAAGAAAAGCTAAAAGAAGG + Intergenic
1017022708 6:150153029-150153051 GTGAAAGCACAGCAAGAAGATGG + Intronic
1017033759 6:150248532-150248554 AAGAAAGTAGAACAATAAGAAGG + Intronic
1017179766 6:151540357-151540379 AAAAAAGCAGCAGCAGAAGAAGG - Intronic
1017523328 6:155221060-155221082 AAGAAAGCAGGGACAGAGGAAGG - Intronic
1017974059 6:159338605-159338627 AAGACAGTAGAGGCAGCAGAAGG - Intergenic
1018414671 6:163590847-163590869 AAGAAAGCAGAGGCGGGAGTGGG - Intergenic
1018502818 6:164430502-164430524 ATGAAAGCTGAGGAAGAAGATGG + Intergenic
1018610724 6:165645278-165645300 AAGAAGGGAGAGCCAGTAAAAGG - Intronic
1018737380 6:166697588-166697610 AAGATGGTAGAGCGAGAAGATGG + Intronic
1019041124 6:169107156-169107178 GTGAAAGCAGATCCAGGAGAGGG + Intergenic
1019324868 7:433056-433078 AGAAAAGCAGAGCCAGAAGTGGG + Intergenic
1021068909 7:16212695-16212717 GAGAAAGCGGAGACAGAGGATGG - Intronic
1021153991 7:17186790-17186812 CAGAAAGCAGAGCCAGGATAAGG - Intergenic
1021313526 7:19118469-19118491 AAGGCAGCAGAGCCAGAGGGGGG + Intergenic
1021444681 7:20719651-20719673 AGGGAAGCAGAGCCAGAGCAGGG + Intronic
1021456186 7:20831651-20831673 AAGGAAAGAGAGCCAGTAGATGG - Intergenic
1021507141 7:21398245-21398267 GAGAAAACAAAACCAGAAGAAGG + Intergenic
1021631107 7:22648474-22648496 AAGAAGGCAGAGGCAGAAAGTGG - Intergenic
1021768188 7:23970077-23970099 AAATAAGCAGAACCAAAAGAAGG + Intergenic
1021907349 7:25348448-25348470 GAGAAGGCAAAGCCAGGAGACGG - Intergenic
1022060883 7:26793948-26793970 AAGAAATCAAAGCCAGAGTAAGG + Intronic
1022334748 7:29411756-29411778 GAGAAAGTAGAGCCTGGAGATGG + Intronic
1022357013 7:29625663-29625685 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1023018433 7:35988029-35988051 AAAAAAAAAAAGCCAGAAGAGGG + Intergenic
1023032306 7:36100950-36100972 AAAAAAGAAGAATCAGAAGAGGG - Intergenic
1023329428 7:39099018-39099040 GAGAAAGCAAAGACTGAAGAAGG - Intronic
1023535913 7:41210229-41210251 AAGAAAGGAGAAAGAGAAGAAGG - Intergenic
1023981707 7:45074243-45074265 AAGAGAGCAGAGCCAGATAGGGG - Intronic
1024329719 7:48143885-48143907 AAAAAGGCAGATCTAGAAGATGG - Intergenic
1024433016 7:49312590-49312612 AACCAAGCAGAGTCAAAAGATGG + Intergenic
1024506552 7:50167108-50167130 AAGGAGGGAGAGCCAGAAAAGGG + Intergenic
1024520400 7:50300722-50300744 AAAACAGCAGAGGCAGAAGCTGG + Intergenic
1024611858 7:51072734-51072756 AAGAAAGAAGTGGGAGAAGAAGG - Intronic
1026009403 7:66625188-66625210 ATCAGAGGAGAGCCAGAAGAGGG + Intergenic
1026319268 7:69254798-69254820 AAGAAGGGAGAGAGAGAAGAAGG + Intergenic
1026364355 7:69632608-69632630 AAGAAAACAGAGAGGGAAGAGGG - Intronic
1026399927 7:69999358-69999380 AAGATAGCAGAAACAGAAGCAGG - Intronic
1026905060 7:74058056-74058078 AAGAAAGAAGAAGAAGAAGAAGG - Intronic
1027332536 7:77114535-77114557 AAGATGGCAGAGCCGGAAGACGG + Intergenic
1028151478 7:87378518-87378540 AAGAAAGCAGTACCAAAAAATGG - Intronic
1028265932 7:88725621-88725643 AGGAAAGCAGAGAAAGCAGAGGG + Intergenic
1028388011 7:90281355-90281377 AAGAAAGCATAGCATAAAGAAGG + Intronic
1029172943 7:98643695-98643717 AAGAGACCAGACCCAGAAGTGGG + Intergenic
1029283556 7:99451684-99451706 AAGAAAATGGAGCCACAAGAGGG - Intronic
1029517019 7:101030944-101030966 CAGAAAGTAAAGCAAGAAGATGG - Intronic
1029574967 7:101397368-101397390 AAGAAAGAAGATGAAGAAGAAGG - Intronic
1029783244 7:102756778-102756800 AAGATGGCAGAGCCGGAAGACGG - Intronic
1029965696 7:104737784-104737806 TAGAAATAAGAGCTAGAAGAAGG - Intronic
1030007953 7:105137015-105137037 AACAAAGCAGAGAAAGGAGATGG + Intronic
1030161178 7:106510038-106510060 AAGAAAGCTTTGGCAGAAGAAGG + Intergenic
1030260015 7:107553967-107553989 AAGAAAACTGAGGCAGAAAAGGG + Intronic
1030978925 7:116163153-116163175 TAGAAAGAAGAGCCAGCAGGAGG + Intergenic
1031018963 7:116605998-116606020 AAGAAAGGAGAGAAAGAGGAAGG + Intergenic
1031897416 7:127367041-127367063 AATAAAGCAGAGTCTGAAAAGGG + Intronic
1031916007 7:127563790-127563812 AAGAAAGCACATCAAGAAGCAGG - Intergenic
1032032466 7:128495767-128495789 AAGGAAGCAGAGTCAGATGGTGG + Intronic
1032062242 7:128734826-128734848 CAGATGGCAGAGCCACAAGATGG - Intergenic
1032319628 7:130874277-130874299 CAGGAAGCACAGCCAGAAGATGG + Intergenic
1032455355 7:132069222-132069244 GAGAGAGCAGACCCAGAAGATGG - Intergenic
1032484181 7:132271136-132271158 GAGACAGAAGAGCCACAAGAGGG + Intronic
1032839985 7:135705910-135705932 AGGAAGGAAGAGCCAGAACAGGG + Intronic
1033006624 7:137571843-137571865 AAGCAAGAAAAGACAGAAGAAGG + Intronic
1033024663 7:137760649-137760671 GAGAGAGGAGAGCCAGAAGGGGG + Intronic
1033077319 7:138261882-138261904 AAGAAAGCAGAGGTAGCAAAGGG - Intergenic
1033114984 7:138617391-138617413 AAGAAGGAGGAGCAAGAAGAAGG + Intronic
1033184947 7:139218872-139218894 GACAGAACAGAGCCAGAAGAGGG - Intergenic
1033232077 7:139607371-139607393 AAGAAAAAAGACCCAAAAGAAGG + Intronic
1033430007 7:141280669-141280691 AAGAAAGCTGCCCCAGAAAATGG - Intronic
1033483519 7:141764871-141764893 AAGTAAGAAGAGAAAGAAGAAGG - Exonic
1033890703 7:146009384-146009406 ATGAAAGAAGAGCAGGAAGATGG + Intergenic
1034248614 7:149670061-149670083 AAAAAAGAAGAAGCAGAAGAAGG - Intergenic
1035828458 8:2669152-2669174 AAGACAGCAGAGCTGGAAGAGGG - Intergenic
1036282573 8:7414471-7414493 AAGAAACCTTAGCCAGAAGAAGG + Intergenic
1036338899 8:7897078-7897100 AAGAAACCTTAGCCAGAAGAAGG - Intergenic
1036712265 8:11087644-11087666 AAGACGGCAGAGCAAAAAGATGG + Intronic
1037125731 8:15346497-15346519 AAAAAATGAGAGACAGAAGAAGG - Intergenic
1037350166 8:17944745-17944767 AAAAAAACTGAGCCAAAAGATGG - Intronic
1038364170 8:26914351-26914373 AAGAAAACAGAGGCAGAAGTTGG + Intergenic
1038402243 8:27293544-27293566 AAGAAAGAAGAGACAGGAGCTGG + Intronic
1039738797 8:40360859-40360881 AAGAGAGCTGAGCTAGAAGATGG - Intergenic
1040006988 8:42629115-42629137 AAGAAAGCGAGGCCAGAGGAGGG - Intergenic
1040629706 8:49196388-49196410 CCCAAAGCAGAGCCAGAAGGAGG - Intergenic
1040863614 8:52025364-52025386 CAGAAAGGAGAGCCAAAAGCTGG - Intergenic
1040948320 8:52908744-52908766 AAGAAAGAAGATAGAGAAGAAGG + Intergenic
1041262595 8:56034828-56034850 CAGACAGCAGAGCCAGCAAAGGG + Intergenic
1041311056 8:56516851-56516873 AAGAAAGCAGAGACAGATTATGG + Intergenic
1041331927 8:56736017-56736039 AAGAAAGCTATGCCAGTAGATGG - Intergenic
1041674691 8:60526393-60526415 AAGAAAGATGAGACACAAGAAGG - Intronic
1042716824 8:71782977-71782999 TATAAAGCAGAGCCAGCACAAGG + Intergenic
1042810377 8:72819198-72819220 TAGAAAGCAGAGCAACAAAATGG - Intronic
1043126908 8:76408843-76408865 AAGAAAGGAAAGCCAGTAGTAGG + Intergenic
1043186278 8:77154617-77154639 AAGAAAGCAGAGTAAGAGGCAGG - Intergenic
1043337897 8:79199689-79199711 ATGAGATCAGAGTCAGAAGAAGG - Intergenic
1043408930 8:79971553-79971575 AAGTATGTAGAGACAGAAGATGG - Intronic
1043528041 8:81117800-81117822 AAGCAAGCAGAGCCAGATGTTGG + Intergenic
1043676340 8:82960370-82960392 AAGAAAGGAAAGGAAGAAGAAGG - Intergenic
1043813905 8:84777935-84777957 AAGAAAACAGACTCAGAAGCCGG - Intronic
1043916157 8:85924927-85924949 AAAAATGCAAAGGCAGAAGAAGG + Intergenic
1044431997 8:92118953-92118975 AAGATAGCAGAGCCATTAGAAGG + Intergenic
1044455495 8:92388238-92388260 AAGAACACACAGCCAGTAGACGG + Intergenic
1044517706 8:93158408-93158430 AGGATAGCAGAGTCAGGAGATGG - Intronic
1044657988 8:94568337-94568359 AAGTACACAGAGCAAGAAGAAGG + Intergenic
1044712224 8:95068971-95068993 AAGAAAGCAGAGTCAAGAGTAGG - Intronic
1044739657 8:95313227-95313249 GAGGAAGAGGAGCCAGAAGAGGG + Intergenic
1044875956 8:96666565-96666587 AAGAAAATAAAGCCAGAACATGG + Intronic
1044891761 8:96843387-96843409 AAGAAAGGAAAGAAAGAAGAAGG + Intronic
1045023057 8:98061224-98061246 GTGAGAACAGAGCCAGAAGATGG + Intergenic
1045107578 8:98907874-98907896 AGGAAAAAAGAGCCAGAGGAAGG - Intronic
1045301354 8:100913356-100913378 AAGAAAGCAAATCAAGCAGAGGG + Intergenic
1045494257 8:102695043-102695065 AAAGAGGCAGAGCCAGAAGTTGG + Intergenic
1045567411 8:103335117-103335139 GAGATGGCAGAGCCACAAGATGG - Intergenic
1045860150 8:106807264-106807286 AGGAAAGCAAAGCCAAAAGATGG + Intergenic
1045866734 8:106874904-106874926 AAGAAATCAGAGACTGAGGAAGG + Intergenic
1045993899 8:108340861-108340883 AAGGATGCAAAGCCAGAAAAAGG + Intronic
1046687784 8:117246090-117246112 AAGAAAGAGGAGAGAGAAGAAGG + Intergenic
1046967146 8:120180562-120180584 AGGAAGGCACAGCCAGGAGATGG - Intronic
1047215491 8:122872838-122872860 AAGAAAGCTGAGCCGAGAGATGG - Intronic
1048054144 8:130847288-130847310 AAAGAAGAAGAGGCAGAAGAAGG + Intronic
1048069358 8:131005422-131005444 AAGAAATAAGAGTCAGGAGAGGG - Intronic
1048493911 8:134919883-134919905 ACGAGAGCAGAGCCACAACATGG - Intergenic
1048668919 8:136695039-136695061 CAGATAGACGAGCCAGAAGAGGG + Intergenic
1048672670 8:136740552-136740574 GAGGAAGCAAAACCAGAAGAGGG + Intergenic
1048734892 8:137488241-137488263 ATGAAAGCATGGCCAGAACATGG + Intergenic
1049092975 8:140530662-140530684 AGGATAGCAGGGCCAGCAGAGGG - Intergenic
1049357823 8:142197403-142197425 AAGAAAGAAGAGCAAAAAAAGGG - Intergenic
1049689296 8:143951767-143951789 AAGAATGCCAGGCCAGAAGACGG + Intronic
1050080040 9:1906612-1906634 AAGATTGCAGAGCCACAAAATGG - Intergenic
1050250608 9:3739985-3740007 AAGAAAGCAGAGAAAGGAGGTGG + Intergenic
1050352865 9:4756918-4756940 AAGAAAGCAGAGGCAAAGAACGG + Intergenic
1050632128 9:7571290-7571312 ATGATGGCAGAGCCAGAAAATGG + Intergenic
1051698902 9:19797915-19797937 AATAGAGCAGAGGCACAAGAAGG - Intergenic
1051822517 9:21184213-21184235 AAGAAAGGAGAGAAAGAAAAAGG - Intergenic
1052557339 9:30033764-30033786 AAGAGGACAGAGGCAGAAGAAGG - Intergenic
1052854739 9:33400270-33400292 AAAAAAACAGAGCAAGGAGAGGG + Intronic
1053100848 9:35371132-35371154 AAGAAAACAGAAACAGAAAATGG - Intronic
1053163196 9:35827910-35827932 AAGAGTGGAGAACCAGAAGATGG + Intronic
1053368404 9:37540622-37540644 GTGAATGCAGAGCCAGAAGATGG - Intronic
1054805978 9:69396081-69396103 TAGAATGCAGAGCAGGAAGAGGG + Intergenic
1054847580 9:69812785-69812807 AACACTGCAGAGCCAGAATAGGG + Intergenic
1055092835 9:72380195-72380217 AAGAAAGGAGAGGGAGAATAAGG - Intergenic
1055638913 9:78304223-78304245 AAGAAAGCAGAGCCAGAAGATGG - Intronic
1055720539 9:79168198-79168220 AGGAAAGGAGAGCTAAAAGATGG + Intergenic
1056732599 9:89178596-89178618 ACGAGAGCAGAGCAAGAGGATGG + Exonic
1056760321 9:89409873-89409895 AAGAGTCCAGAGCCAGGAGATGG + Intronic
1056855069 9:90120247-90120269 AGGGAAGCAGAGTAAGAAGATGG - Intergenic
1057730839 9:97606923-97606945 AAGACAGGAAAGCTAGAAGATGG + Intronic
1058596013 9:106616475-106616497 AACAAAGGAGAGGGAGAAGAAGG + Intergenic
1058832385 9:108830985-108831007 GAGAAAGCAGAGGTAGAAGAAGG + Intergenic
1058876967 9:109252776-109252798 GAGAAAGAAGAGCTACAAGATGG + Intronic
1059081759 9:111257396-111257418 GAGAAAGTAGATCCAGAATAAGG + Intergenic
1059139462 9:111838732-111838754 AAGGAAGCAGATCAAAAAGAAGG - Intergenic
1059235318 9:112755777-112755799 AAGAAAGCAGAGCCAAGAGATGG - Intronic
1059347828 9:113643542-113643564 AAGAAGGCAGGGAGAGAAGAAGG - Intergenic
1059386178 9:113966296-113966318 AAGATCGCAGAGCTAGAAAACGG + Intronic
1059676122 9:116541653-116541675 ATGGAAGCAGAGACAGAACAAGG + Intronic
1059849090 9:118316983-118317005 AAGGAAACAGATCCAGAAGCAGG - Intergenic
1059950426 9:119456385-119456407 AAGAAAGGAGAACTAGAAGTAGG + Intergenic
1060049238 9:120365599-120365621 CAGAAAGGAGAGAGAGAAGAGGG + Intergenic
1060570461 9:124634434-124634456 AAGAAACAAGAGACAGAAAATGG - Intronic
1061388062 9:130302033-130302055 AAAAAAGCACAGCTAGAGGATGG - Intronic
1061632702 9:131883251-131883273 ATGAGACCAGAGACAGAAGATGG + Intronic
1062161262 9:135081461-135081483 GAGAAAGCAGGGCAAGAAGGAGG + Intronic
1203451934 Un_GL000219v1:125543-125565 AAGAAAGAAGAGGAAGAAAATGG - Intergenic
1185686737 X:1935033-1935055 AAGAAAGAAGAGGAAGAAGAAGG + Intergenic
1185695121 X:2188335-2188357 AAGAAAGCAAAGGAAAAAGAAGG - Intergenic
1185814483 X:3142362-3142384 AAGAAAGGAGAAGAAGAAGAAGG + Intergenic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1185991651 X:4897984-4898006 AAGAAGGCTGAGGCAGTAGAAGG - Intergenic
1186050089 X:5582960-5582982 AAGCAAGAATAGCCAGGAGAGGG - Intergenic
1186197915 X:7128527-7128549 CAGAAAGCAGAGCATGAAAAAGG + Intronic
1186341453 X:8650356-8650378 CAGAAATCAGAGCTAGAAGATGG + Intronic
1186675120 X:11808410-11808432 AAGAAAGGACAGTGAGAAGAAGG + Intergenic
1186956764 X:14690838-14690860 AAGACAGAAGAGGCAGAATAAGG + Exonic
1186965527 X:14782689-14782711 AAGAAGGCAGAGCCAGGAGATGG + Intergenic
1186980610 X:14954178-14954200 AAGATGGCAGAGCCATAAGGTGG + Intergenic
1187025810 X:15434275-15434297 AAGAAAGAGGAGAAAGAAGAAGG + Intronic
1187114792 X:16338205-16338227 AGGAAAGCACAGCCACCAGAAGG + Intergenic
1187228978 X:17403072-17403094 AAGATAGCAGAGACAAAAGATGG - Intronic
1187294124 X:17982813-17982835 AAGAAGGCAGAGCGAGGAGATGG - Intergenic
1187572189 X:20515981-20516003 AAGATGGCAGAGCCACAGGATGG + Intergenic
1187736267 X:22307051-22307073 AAGAGAGGAGGGCCAGAGGATGG - Intergenic
1187847872 X:23559560-23559582 AGGATAGCAGAGCAACAAGATGG + Intergenic
1187948006 X:24445291-24445313 AGGAAGGCAGAGCCACAGGAAGG - Intergenic
1187990804 X:24870072-24870094 ATGTAAGCTGGGCCAGAAGAAGG + Intronic
1188218049 X:27502994-27503016 AAGAAAGAGGAGAAAGAAGAGGG + Intergenic
1189215772 X:39321842-39321864 AAGATGGCAAAGCCACAAGATGG - Intergenic
1189298004 X:39932520-39932542 AGGAAAGTAGAGCCAGGAGGGGG + Intergenic
1189544094 X:42023838-42023860 AATACAGTAGAGCCATAAGATGG - Intergenic
1190723649 X:53172095-53172117 AAGAAAAGAGAGGAAGAAGAGGG + Intergenic
1190757228 X:53411756-53411778 AAGAAAGTAGAGACAGAGGTGGG - Exonic
1191197025 X:57735755-57735777 AAGAGGGCAGAGCAAGATGATGG + Intergenic
1191752264 X:64555764-64555786 AAGAAAGAAGAAAAAGAAGAAGG + Intergenic
1192133385 X:68574101-68574123 AAGATGGCAGAGCCATAAGATGG + Intergenic
1192687519 X:73322846-73322868 TGGAAAGCAAAGCCAGGAGAGGG - Intergenic
1192822790 X:74662022-74662044 TTGAAAGCAGAGCAAGAAGGTGG - Intergenic
1193159625 X:78214060-78214082 AGGAAAGCAGATCTAGAAGATGG + Intergenic
1194291195 X:92073355-92073377 GAGAAGGCAGAGCAAGATGATGG - Intronic
1195676636 X:107511847-107511869 CAGAATGCTAAGCCAGAAGAGGG - Intergenic
1195799377 X:108689752-108689774 AAGAAAGAAGACAGAGAAGATGG + Intronic
1195871538 X:109491522-109491544 AAGAGAGCAGAGCCAAAGAATGG - Intergenic
1196055973 X:111355691-111355713 AAGAACACAGAGCCAAGAGAAGG + Intronic
1196795777 X:119501061-119501083 AAGAAGGCAGGGCCAGTGGAAGG - Intergenic
1196941379 X:120779594-120779616 AAGGAAGCAGAACCGTAAGATGG + Intergenic
1197826357 X:130594530-130594552 AAGTGTGCAGAGACAGAAGAAGG + Intergenic
1198686305 X:139231212-139231234 AAAAAAGCAGGGCCTGAAGCTGG + Intergenic
1198795009 X:140385277-140385299 AAGAAAGCAAAAGCAGAAGAGGG - Intergenic
1199456280 X:148032849-148032871 AAGAAATCAGAGCCAGAACTAGG - Intergenic
1199605145 X:149571895-149571917 AAGCAGGCATAGCCAGAAGGTGG + Intergenic
1199697143 X:150350804-150350826 AAGGAAGAAGAGCCAAAACAAGG + Intergenic
1199800790 X:151248638-151248660 CAGGGAGCAGAGCCAGAAGGGGG + Intergenic
1200608708 Y:5297938-5297960 GAGAAGGCAGAGCAAGATGATGG - Intronic
1200751399 Y:6947252-6947274 AAGAGAACATAGCCAGAGGAAGG + Intronic
1201539728 Y:15092805-15092827 AAGAAAGAAGAGACATAGGAGGG + Intergenic