ID: 1055638918

View in Genome Browser
Species Human (GRCh38)
Location 9:78304262-78304284
Sequence GGGTGGCCACCATTGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055638913_1055638918 16 Left 1055638913 9:78304223-78304245 CCATCTTCTGGCTCTGCTTTCTT No data
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data
1055638912_1055638918 17 Left 1055638912 9:78304222-78304244 CCCATCTTCTGGCTCTGCTTTCT No data
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data
1055638910_1055638918 19 Left 1055638910 9:78304220-78304242 CCCCCATCTTCTGGCTCTGCTTT No data
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data
1055638911_1055638918 18 Left 1055638911 9:78304221-78304243 CCCCATCTTCTGGCTCTGCTTTC No data
Right 1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638918 Original CRISPR GGGTGGCCACCATTGGTTGC AGG Intronic