ID: 1055638919

View in Genome Browser
Species Human (GRCh38)
Location 9:78304268-78304290
Sequence GCTAATCCTGCAACCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638919 Original CRISPR GCTAATCCTGCAACCAATGG TGG (reversed) Intronic
901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG + Exonic
904389502 1:30172626-30172648 GCAAATCCTTCTACCACTGGGGG + Intergenic
918198188 1:182242342-182242364 GCTAATCCTGCAGCATTTGGGGG + Intergenic
1063319560 10:5040118-5040140 GCAAATCCTACACACAATGGTGG + Intronic
1071854833 10:89613677-89613699 GCAAATTCTGCAACCAGTGTAGG + Intronic
1072603908 10:96961238-96961260 GCTAATTCTGCAACCGTTTGGGG + Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1080684271 11:34502514-34502536 GCTAATCCTCCCACCTGTGGAGG + Intronic
1081855081 11:46297806-46297828 GCTGAGCTTGGAACCAATGGTGG - Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1098431461 12:70424306-70424328 GATAATCTTGAAACCAATGCTGG + Intronic
1099895838 12:88645431-88645453 TTTAATCCTGCATCCAATGTAGG + Intergenic
1103806209 12:123575148-123575170 GCTAATTCTGCTTCCAAAGGAGG - Intergenic
1107537855 13:41353185-41353207 GCTAAAACTGCAACCAGAGGTGG - Intronic
1108822832 13:54374810-54374832 CCTGATCAAGCAACCAATGGTGG + Intergenic
1110397278 13:75045777-75045799 GCAAATCCTGTTACCAATGGCGG + Intergenic
1115269202 14:31533006-31533028 GCAAATCATGCACCCAATGAGGG - Intronic
1118730097 14:68659831-68659853 GCTCAGCCTGCTGCCAATGGAGG + Intronic
1128158142 15:65404732-65404754 GCTATTGCTGCAGCCAATAGAGG + Intronic
1131227216 15:90634791-90634813 GCTAAAACTGTAACCAAAGGAGG + Intronic
1132033776 15:98462095-98462117 TCTAATTCTGCAAAGAATGGTGG - Intronic
1133387753 16:5384154-5384176 GCAATTCCTGCAGCCAAGGGTGG + Intergenic
1139951390 16:70673361-70673383 GCTGACCTTCCAACCAATGGTGG + Intronic
926591637 2:14745907-14745929 GCTAGTTCTGGAACCAATGTGGG + Intergenic
935728309 2:106043403-106043425 GCTAATCCTGAAACCCTGGGTGG - Intergenic
1179308270 21:40174612-40174634 GCTGATCCTTCAATGAATGGAGG + Intronic
1179566583 21:42252813-42252835 CCTAAACCTGCTGCCAATGGGGG - Intronic
1183142346 22:35954604-35954626 CCTAATCATGTAAGCAATGGAGG - Intronic
1183623228 22:38986833-38986855 GCTATTCCTCCCTCCAATGGTGG + Intronic
1183633477 22:39047172-39047194 GCTATTCCTCCCTCCAATGGTGG + Intronic
950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG + Intergenic
953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG + Intronic
957798906 3:85049306-85049328 ACTAAACCTGCAACAAATGTAGG - Intronic
962707150 3:138055031-138055053 GCTATTCCTGCAAAAAATGTTGG - Intergenic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
965375606 3:167919738-167919760 GAAAATCATGCAGCCAATGGGGG + Intergenic
969386891 4:6857430-6857452 GAGATTCCTGCAACCAAGGGAGG + Intronic
974261782 4:59534454-59534476 GCTAAACGAGCAACCAAAGGAGG - Intergenic
975490006 4:74977473-74977495 GCTGAACCTACAACTAATGGGGG + Intronic
979019909 4:115483270-115483292 GCTAAACTTGCAACAAATGATGG + Intergenic
980422328 4:132579864-132579886 GCTATTCCGCCAACCCATGGTGG - Intergenic
992339966 5:75813807-75813829 GCTAATCCTGGAAGCAACAGAGG - Intergenic
996041307 5:118815625-118815647 GCTAATACTGCATGAAATGGGGG + Intergenic
996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG + Intergenic
999356464 5:150938263-150938285 GCAAATCATCAAACCAATGGTGG + Intergenic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1028878937 7:95857214-95857236 GCTATTGCTGCAACTAAAGGAGG - Intronic
1041632733 8:60106209-60106231 GCTATTCCTCCAATCAAAGGTGG - Intergenic
1041837445 8:62232481-62232503 GCTAATCCTGCACCTGTTGGAGG - Intergenic
1042141426 8:65682872-65682894 GCTGATCTTGAAACCAATGACGG - Intronic
1042685156 8:71430689-71430711 GTTATCCCTGAAACCAATGGGGG + Intronic
1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG + Intronic
1053446865 9:38159335-38159357 GCTAATCCTGACAGCACTGGGGG + Intergenic
1054799371 9:69331934-69331956 GCTACTGCTGCCACCAAGGGAGG + Intronic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1058070920 9:100599714-100599736 GCTGAACCCGCAACCAAAGGAGG - Intergenic
1058418802 9:104816055-104816077 GATAATCCTGCTCCCAATGCAGG + Intronic
1194969060 X:100322618-100322640 TCTAATCCTGCAAAGAATGATGG + Intronic