ID: 1055638958

View in Genome Browser
Species Human (GRCh38)
Location 9:78304547-78304569
Sequence ATCCTTGGACAACTATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055638958_1055638960 2 Left 1055638958 9:78304547-78304569 CCAGTAAATAGTTGTCCAAGGAT 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055638960 9:78304572-78304594 CATAAATAAATGAGTGAATTAGG 0: 1
1: 1
2: 12
3: 82
4: 902
1055638958_1055638961 3 Left 1055638958 9:78304547-78304569 CCAGTAAATAGTTGTCCAAGGAT 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055638961 9:78304573-78304595 ATAAATAAATGAGTGAATTAGGG 0: 1
1: 4
2: 21
3: 255
4: 2177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055638958 Original CRISPR ATCCTTGGACAACTATTTAC TGG (reversed) Intronic
900738080 1:4311986-4312008 ATTCTTGGACAAGTATTTGGTGG + Intergenic
902647453 1:17810376-17810398 ATCCATGAAAAAGTATTTACAGG - Intronic
906952227 1:50344239-50344261 AACCTGGGACAAGTATTTGCTGG + Intergenic
909356389 1:74714819-74714841 TTCCTTGAACAAATATTTATTGG + Intronic
910671021 1:89772800-89772822 ATACCTGGACAACTATCTGCAGG - Intronic
910824565 1:91391917-91391939 ATCCTTTGCCAACTTTTTAATGG - Intronic
911787648 1:101970537-101970559 CTCCTTTTACAAATATTTACTGG + Intronic
914407539 1:147390779-147390801 ATCCTTTGCCCACTATTTAATGG - Intergenic
920523575 1:206648390-206648412 ATCCTTGCAGAACTTTTAACAGG + Exonic
921462153 1:215442173-215442195 ATCCTTTGCCCACTTTTTACTGG + Intergenic
921766011 1:218973328-218973350 AGCCTTGGACAGCTCTTCACAGG - Intergenic
923160374 1:231309703-231309725 ATCCTTTTACATATATTTACTGG - Intergenic
1066307207 10:34157080-34157102 ATCCATGTACAACTATTCTCAGG - Intronic
1066355861 10:34683261-34683283 AGGCTTGCAAAACTATTTACCGG + Intronic
1074530995 10:114298723-114298745 ATCATTTGACAGCTATTTCCTGG - Intronic
1077697585 11:4408482-4408504 ATCCTTTGCCAACTTTTTAATGG - Intergenic
1077929586 11:6717094-6717116 AGGCTTGGACAACTATTTGTAGG + Intergenic
1079768732 11:24430848-24430870 CTCCTTGGACAACTTTCTTCAGG - Intergenic
1080105076 11:28503323-28503345 ATACTTTGACCACTATTTCCAGG + Intergenic
1080233188 11:30041033-30041055 ATCCTTGGAAAACAACTCACAGG + Intergenic
1080665432 11:34331897-34331919 ATCCTTGGAAATGTATTTCCTGG + Intronic
1083058934 11:59849440-59849462 GTCCTTGGTTAACTATTGACTGG + Intergenic
1083443567 11:62692333-62692355 AACCTTGGGCAACTCTTCACGGG - Intronic
1085215727 11:74829164-74829186 ATCCTTTGTCCACTTTTTACTGG - Intronic
1095480711 12:42632420-42632442 ATCATTTCAAAACTATTTACTGG - Intergenic
1097350630 12:58544761-58544783 ATCCTTGGAGAAATATTAAAAGG + Intronic
1099736233 12:86569354-86569376 ATCCTTTGCCAACTTTTTAATGG - Intronic
1101122603 12:101598534-101598556 ATCCTGCGACAACTGTTAACTGG + Intronic
1101975607 12:109355461-109355483 ATCCATGGACCACAATTTAAGGG + Intronic
1104436664 12:128762281-128762303 GTCCTGGGAGAACTATTTAGTGG + Intergenic
1110336647 13:74340064-74340086 ATCCTTCGTCCACTTTTTACAGG + Intergenic
1110461786 13:75753242-75753264 ATCCTTGGCCCACTTTTTAATGG + Intronic
1111068550 13:83131876-83131898 ATCCATGGAAAACTCTTCACAGG - Intergenic
1114560444 14:23586019-23586041 ATCCTTTGCCCACTTTTTACTGG + Intergenic
1115558773 14:34564351-34564373 ATCCTTGGCCCACCATGTACTGG + Intronic
1116342470 14:43741895-43741917 ATCCTTGGACAATATTTTATCGG + Intergenic
1117280997 14:54240970-54240992 ATCCTTTGAAAACTATCTAGGGG - Intergenic
1117902163 14:60545801-60545823 ATCTTTTGACAACTTTTTAATGG + Intergenic
1121795325 14:96729795-96729817 TTCCTTGGACATTTATTTATTGG + Intergenic
1122148999 14:99714056-99714078 ATCCTTTGCCAACTTTTTAATGG - Intronic
1126480678 15:49116401-49116423 ATCCTTTGACTACTTTTTAATGG - Intronic
1132078274 15:98841288-98841310 ATCCTTGGCCTGCCATTTACTGG + Intronic
1136042166 16:27588428-27588450 ATCCTTGGAGAGGTATTAACTGG - Intronic
1136855574 16:33654002-33654024 ATCCTTGGACCACTTTTTGATGG - Intergenic
1138111388 16:54326930-54326952 ATCCTTTGAGAACTATTGAGGGG - Intergenic
1138159144 16:54737012-54737034 TTCATTTGACAACTATTTATTGG + Intergenic
1138416115 16:56872383-56872405 CTCCTTTGCCAACTATTTAGTGG + Exonic
1140019236 16:71221496-71221518 GTCCTTGGAAAATTATTTATGGG - Intronic
1140293857 16:73689115-73689137 ATCCTTTGGCAAGTATTTATTGG - Intergenic
1141753369 16:85974774-85974796 ATATTTGGACAACATTTTACAGG + Intergenic
1203117160 16_KI270728v1_random:1502483-1502505 ATCCTTGGACCACTTTTTGATGG - Intergenic
1158627052 18:59080554-59080576 ATACTTGGAGTACTATTTATAGG + Intergenic
925419420 2:3699820-3699842 GTCCTTGGCCAACTTTTTAATGG + Intronic
928305644 2:30168146-30168168 ATGGTTGTACAATTATTTACTGG + Intergenic
930318235 2:49823165-49823187 ATCCTTTGACCACTTTTTAATGG + Intergenic
937513441 2:122625590-122625612 ATCCTTGGTGAACAATTTAATGG + Intergenic
938546720 2:132339686-132339708 ATAGTATGACAACTATTTACAGG - Intergenic
938893595 2:135729244-135729266 ATCACTGGACAAATGTTTACTGG - Intergenic
939033750 2:137106711-137106733 ATCCTTTGACCACTTTTTAATGG - Intronic
940927227 2:159378023-159378045 TAACTTGGACAACTATGTACTGG - Intronic
943088781 2:183349471-183349493 ATCACTGGAGAACTATTTAAGGG - Intergenic
945535979 2:211018517-211018539 ATCCTTGGCCCACTTTTTAATGG + Intergenic
1170514176 20:17110658-17110680 ATCCTTGGCCCACTTTTTAATGG + Intergenic
1171875583 20:30572412-30572434 ATAGTATGACAACTATTTACAGG - Intergenic
1172629448 20:36368121-36368143 TTCCTTCCACAGCTATTTACTGG - Intronic
1173692466 20:44973669-44973691 ATCCTTGCTCTACTGTTTACTGG + Intronic
1177515820 21:22149343-22149365 ATAAATGGACAACTATTTAAAGG - Intergenic
1178265625 21:31140723-31140745 TTCCTTTGACAACTATTTTTTGG + Intronic
1178527547 21:33344548-33344570 ATCCTTTCACAACTTTTTTCAGG + Intronic
1181393698 22:22602888-22602910 ATCCTTGGAGCACAATTTACAGG - Intergenic
1181418411 22:22777868-22777890 ATTCTTGGCCCACTATTTAATGG - Intronic
1182686614 22:32125178-32125200 TTCCTTGAATAACTACTTACAGG - Intergenic
1183526700 22:38327394-38327416 ACCATTGCACAAGTATTTACGGG - Intronic
954347353 3:50011453-50011475 ATCCTTGGACTAATTTTTAGGGG + Intronic
957337263 3:78847453-78847475 TTCCTTAGACAACTATTTTGAGG - Intronic
957376594 3:79366664-79366686 ATCATTGAACAAATATTTATTGG - Intronic
965477618 3:169176788-169176810 ATTCTTTGACAACTTTTTAATGG - Intronic
966937230 3:184718813-184718835 CTCCTTGGAGAATTATCTACAGG - Intergenic
968198174 3:196727957-196727979 CTCCTTGGACAAATAGTTAGGGG - Exonic
971080479 4:23204535-23204557 ATCCTTTGCCCACTATTTAATGG + Intergenic
974241633 4:59256572-59256594 ATCCTTGAACAAGTATATTCAGG - Intergenic
977042860 4:92036300-92036322 ATCCTTAAACAACAACTTACTGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979174302 4:117643257-117643279 ATCATTGAACAAGTATTTATTGG + Intergenic
981262894 4:142743424-142743446 ATCCTTGGCCAAGAATTCACAGG - Intronic
983304625 4:165970740-165970762 ATCTTTGGATAACCATATACAGG + Intronic
983304785 4:165972311-165972333 ATCTTTGGATAACCATATACAGG - Intronic
984037665 4:174690774-174690796 ATCCTTGGCAAACTAATTGCAGG - Intronic
986488619 5:8266405-8266427 AACCTTGGATTACTATCTACAGG + Intergenic
987598280 5:20030465-20030487 ATCCTGGAACAAATATTTATTGG - Intronic
987987076 5:25161549-25161571 ATCCTTAGACAACAACTTCCTGG + Intergenic
988273739 5:29053362-29053384 ATCCTTGGACAACTGACTACAGG + Intergenic
990656653 5:57964352-57964374 ATCCTTTGCCAACTTTTTAACGG + Intergenic
994680006 5:102874939-102874961 ATCCTTGTTCTCCTATTTACCGG - Intronic
996181703 5:120427236-120427258 ATCCTTTGCCAACTTTTTAATGG + Intergenic
996928224 5:128854936-128854958 ATCATTCAACAAATATTTACCGG + Intronic
997273975 5:132567087-132567109 ATCATTCAACAAATATTTACAGG - Intronic
997814935 5:137007460-137007482 ATCCTTTGCCAACTTTTTAATGG - Intronic
999075232 5:148789313-148789335 AGCCTTGGACAATTATATTCAGG - Intergenic
1000938119 5:167327702-167327724 ATCCTTGGATCTCTATATACTGG - Intronic
1005247621 6:23906592-23906614 ATCCTTTGTCAACTTTTTAATGG + Intergenic
1009736410 6:67681754-67681776 ATCCTTAGAGACCTATTTATTGG - Intergenic
1010578861 6:77568668-77568690 ATACTTGGAATTCTATTTACAGG - Intergenic
1011463750 6:87633523-87633545 TTCCTTGGTCAACGATCTACGGG - Intronic
1012784996 6:103613218-103613240 ATTCCAGGACAATTATTTACTGG + Intergenic
1013203543 6:107925488-107925510 ATCCTTCTATAACTATTTATTGG - Intronic
1013998250 6:116334720-116334742 ATCCTTTGCCAACTTTTTAATGG - Intronic
1020269839 7:6588237-6588259 ATCCTTGTACATCTATTTTTGGG + Intronic
1021466015 7:20944342-20944364 ATCATTCAACAAGTATTTACTGG + Intergenic
1021779990 7:24094757-24094779 GTCCTTGGCCAACTTTTTAATGG + Intergenic
1028787169 7:94808660-94808682 ATCCTTTGACCACTTTTTAATGG - Intergenic
1029986048 7:104924426-104924448 ATTCATAGACAACTATTTATTGG + Intergenic
1030365600 7:108642307-108642329 ATCCTTTGGCAACTAATTACTGG + Intergenic
1036592424 8:10181106-10181128 ATCTGCGGACAAGTATTTACTGG - Intronic
1038226319 8:25661322-25661344 ATCTTTGGAAAAATATTTGCAGG - Intergenic
1038242855 8:25826008-25826030 ATCCTTTGACAACTTTTTGATGG + Intergenic
1044702182 8:94974898-94974920 ACCCTTGGACAAACATCTACAGG - Intronic
1047105613 8:121727464-121727486 ATCCTTTGAAAACTATGTAGAGG + Intergenic
1047726022 8:127684609-127684631 ATTATTGGACAATTATTTACCGG - Intergenic
1048268290 8:133006557-133006579 TTCATTCAACAACTATTTACGGG - Intronic
1055638958 9:78304547-78304569 ATCCTTGGACAACTATTTACTGG - Intronic
1059505816 9:114799028-114799050 ATCCTTGGGCAAGTATAAACAGG - Intronic
1190314804 X:49143751-49143773 ATCCTTGGACAACAGTAGACTGG - Intergenic
1190958130 X:55217575-55217597 ATCCTTGGTCCACTTTTTAATGG + Intronic
1191628455 X:63294654-63294676 ATCCTTAGCCCACTATTTAACGG - Intergenic
1192243809 X:69357268-69357290 ATCCTTGCACCACTGTTTACTGG - Intergenic
1193491588 X:82156629-82156651 ATCCTTGGAAAAGTAACTACTGG - Intergenic
1193721088 X:84988456-84988478 AGCCTTGGACAAATATTGAGTGG + Intergenic
1196415633 X:115468022-115468044 AACCTTGGAAAACTTTTTAAAGG - Intergenic
1197028861 X:121789387-121789409 ATCCTGGCTCCACTATTTACAGG + Intergenic
1199252464 X:145679004-145679026 ATTCTTTGACAAATATTTACTGG + Intergenic
1199423839 X:147678138-147678160 ATCCTTGGCCCACTTTTTAATGG - Intergenic
1199702866 X:150397919-150397941 ATGCTTGGACATATATTTCCAGG + Intronic