ID: 1055640870

View in Genome Browser
Species Human (GRCh38)
Location 9:78317989-78318011
Sequence CCCTGGGGCTCTCAGGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 891
Summary {0: 1, 1: 2, 2: 23, 3: 198, 4: 667}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055640864_1055640870 -9 Left 1055640864 9:78317975-78317997 CCTCCTGTACCTCACCCTGGGGC 0: 1
1: 0
2: 2
3: 24
4: 305
Right 1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG 0: 1
1: 2
2: 23
3: 198
4: 667
1055640857_1055640870 24 Left 1055640857 9:78317942-78317964 CCCATGAGCAGGGGAGTGGGTGG 0: 1
1: 0
2: 3
3: 34
4: 287
Right 1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG 0: 1
1: 2
2: 23
3: 198
4: 667
1055640856_1055640870 25 Left 1055640856 9:78317941-78317963 CCCCATGAGCAGGGGAGTGGGTG 0: 1
1: 0
2: 3
3: 29
4: 233
Right 1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG 0: 1
1: 2
2: 23
3: 198
4: 667
1055640862_1055640870 -8 Left 1055640862 9:78317974-78317996 CCCTCCTGTACCTCACCCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 309
Right 1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG 0: 1
1: 2
2: 23
3: 198
4: 667
1055640859_1055640870 23 Left 1055640859 9:78317943-78317965 CCATGAGCAGGGGAGTGGGTGGT 0: 1
1: 0
2: 2
3: 44
4: 343
Right 1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG 0: 1
1: 2
2: 23
3: 198
4: 667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055640870 Original CRISPR CCCTGGGGCTCTCAGGCTTT GGG Intronic
900116304 1:1029151-1029173 CACTGGGGCTCTCTGGCAATTGG - Intronic
900192997 1:1359236-1359258 CCCTGGGGCTGCCCGCCTTTAGG + Intronic
900376075 1:2355479-2355501 CCCCGAGGCTCTGAGGCTCTGGG + Intronic
900387427 1:2416933-2416955 CCCTGGGGCTCTGGGGCTCTGGG + Intergenic
900488025 1:2932729-2932751 CCTTGGGGCTTGCAGGCTGTTGG + Intergenic
900764217 1:4493230-4493252 GCCAGGGGCTATCAGGCCTTTGG + Intergenic
900879574 1:5371005-5371027 GCCAGGGGCTCTAGGGCTTTTGG + Intergenic
900922977 1:5685349-5685371 CCTGAGGGCTCTCAGGCTGTAGG + Intergenic
901005323 1:6169072-6169094 CCCTGGGGTCCTCAGGTTTGGGG - Intronic
901154433 1:7125857-7125879 CGTTGGGGCTTTGAGGCTTTGGG - Intronic
901373320 1:8818504-8818526 CCCTGTGATTATCAGGCTTTCGG - Intergenic
901478771 1:9509507-9509529 GCCAGGGGCTCCCAGGCCTTCGG + Intergenic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
901669838 1:10849780-10849802 CTCTGGGAGTCCCAGGCTTTTGG - Intergenic
901766538 1:11503462-11503484 CCCTGGGGTTCCCAGGCCTTTGG - Intronic
901852132 1:12022336-12022358 CTCTGGGTCCCTCAGGCTTGAGG - Exonic
902206704 1:14873592-14873614 CCAGGGGCCTTTCAGGCTTTTGG + Intronic
902618034 1:17634588-17634610 CTCTGGGGCTCTGGGGCTCTGGG + Intronic
902868614 1:19298262-19298284 GTCGGGGGCTCTCAGGCCTTTGG + Intergenic
903166772 1:21525624-21525646 CCCTGGGCCTCACAGGCAGTTGG - Intronic
903538556 1:24083387-24083409 GCCAGGAGCTCTCAGGCCTTCGG + Intronic
903702726 1:25262670-25262692 CGCTGGGGTTCTAAGGCCTTTGG - Intronic
903711991 1:25332996-25333018 CGCTGGGGTTCTAAGGCCTTTGG - Intronic
903858967 1:26353946-26353968 CCCTGGGCCTCTCCAGCTCTAGG - Intronic
904492381 1:30869176-30869198 CCCAGGGGAACTCTGGCTTTAGG - Intergenic
904845337 1:33408860-33408882 TCCTGGGGCTCTCAAGCCCTGGG - Intronic
905809530 1:40901985-40902007 CACTGGTCCTCTCTGGCTTTGGG + Intergenic
906150889 1:43587067-43587089 CTCTGGGGCTGCCAGGGTTTGGG + Intronic
906397107 1:45475921-45475943 GCCAGGGGCTCTCAGGCCTTTGG + Intronic
906769946 1:48474969-48474991 CCATGTGGCTATCAGGCTTTTGG - Intergenic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
907625758 1:56027804-56027826 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
907654525 1:56328778-56328800 CCTTGGGGCTCTTAAGCTCTCGG + Intergenic
908039020 1:60087192-60087214 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
908428387 1:64031395-64031417 CCCTGGGGGGCTCAGGCTGCTGG - Intronic
909237107 1:73166844-73166866 GTCGGGGGCTCTCAGGCCTTCGG - Intergenic
909656026 1:78033644-78033666 GCCTGGGGTTCTGTGGCTTTGGG + Intronic
909834921 1:80241790-80241812 CCCCTGGGCTCTCAGGACTTTGG + Intergenic
910630550 1:89348976-89348998 GCCAGTGGCTCTCAGGCCTTCGG + Intergenic
911291871 1:96066149-96066171 GCCAGGGGCTTTCAGGCCTTTGG + Intergenic
911307405 1:96247639-96247661 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
912025100 1:105160071-105160093 GCCAGGGGCTGTCAGGCCTTTGG - Intergenic
912109114 1:106318330-106318352 GCCAGGGGGTCTCAGGCCTTTGG - Intergenic
912119777 1:106455934-106455956 GCCAGGGGCTGTCAGGCCTTTGG - Intergenic
912566037 1:110588098-110588120 CCCAGGGGCTTTCGGGCCTTTGG - Intergenic
912590143 1:110809732-110809754 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
913036460 1:114970698-114970720 CAGTGGAGCTATCAGGCTTTAGG + Intronic
913201124 1:116495932-116495954 GCCGGGGCCTCTCAGACTTTGGG + Intergenic
913242729 1:116843628-116843650 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
915623171 1:157098559-157098581 CTCTGGGGCACTCAGGGTCTAGG + Intronic
915680343 1:157575803-157575825 CCCAGTGGCTCTCAGACTCTAGG - Intronic
915732254 1:158061994-158062016 CCCTGGTGTTCACATGCTTTGGG + Intronic
915925182 1:160012046-160012068 TCCCAGGGCTCTCAGGCCTTTGG - Intergenic
916919546 1:169449597-169449619 GCCAGGGGCTCTTAGGCCTTCGG - Intronic
918236324 1:182583791-182583813 GCCAGGGGCTTTCAGGCCTTTGG + Intronic
918249324 1:182687315-182687337 TCCTGGAGCCCTCAGGCTTATGG - Intergenic
918407052 1:184221898-184221920 GCCAGGGACTCTCAGGCCTTCGG + Intergenic
918564944 1:185918234-185918256 GCCAGGGGCTCTCGGGCCTTTGG - Intronic
918656065 1:187027720-187027742 CCCTGGGGATCTCAGGCATCTGG + Intergenic
918706518 1:187669340-187669362 TGCTGGGGTTCTCAGGCTTTTGG - Intergenic
918887254 1:190211011-190211033 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
918940017 1:190981659-190981681 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
919268386 1:195304380-195304402 GCCAGGGGCTCTCGGGCTGTCGG + Intergenic
919318416 1:196002951-196002973 GTCAGGGGCTCTCAGGCCTTTGG + Intergenic
920555593 1:206901884-206901906 GCCCTGGGCTCTCAGGCTTTGGG + Intronic
921544040 1:216453022-216453044 GTCAGGAGCTCTCAGGCTTTTGG + Intergenic
921846134 1:219884183-219884205 CCCTGGGGCACTCTGACCTTTGG - Intronic
922043284 1:221918175-221918197 GCCAGAGGCTCTCAGGCCTTCGG + Intergenic
922484818 1:225965445-225965467 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
922620855 1:226987251-226987273 GCCTGGGCCTCGCAGGCTTAAGG - Exonic
922861659 1:228823125-228823147 CCCAGGGGCTCTCAGGCCTTTGG - Intergenic
923180099 1:231509195-231509217 CCCTGGGGCTCTCTGCCCTGAGG + Intergenic
923385522 1:233462034-233462056 CCCCTGGGTTCTCAGGCCTTTGG - Intergenic
923391942 1:233520942-233520964 CCTGGAGGCTCTCAAGCTTTTGG + Intergenic
923946978 1:238899077-238899099 GCCTGGGGCTTTCTGGCCTTTGG - Intergenic
924135085 1:240957309-240957331 GCCAGGGGCTCTCAGGTCTTCGG + Intronic
924293619 1:242563678-242563700 ACCAGGGACTCTCAGGCCTTTGG + Intergenic
1063014067 10:2057382-2057404 GCCAGGGGCTCTCGGGCCTTCGG + Intergenic
1063175277 10:3545051-3545073 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1063525395 10:6779749-6779771 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
1063827121 10:9910655-9910677 GTCAGGGGCTCTCAGGCTTTTGG - Intergenic
1064004848 10:11691485-11691507 ACCTGGGGCTGTCACACTTTGGG + Intergenic
1064177864 10:13090951-13090973 GCTGGGGGCTCTCAGGCTTTTGG - Intronic
1064329096 10:14377051-14377073 GCCAGGGGCTCTCGGGCCTTCGG + Intronic
1064360876 10:14663122-14663144 GCCAGGGGCTCCCAGGCCTTCGG + Intronic
1064363676 10:14688219-14688241 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
1064367026 10:14717468-14717490 CCCAGGGGCTCTCAGACTTAGGG - Intronic
1064854874 10:19754757-19754779 GCCAGGGGCTCTCAGGCCTTTGG + Intronic
1065155871 10:22869626-22869648 GCCAGGGGCTCTCGGGCCTTCGG + Intergenic
1065226865 10:23552427-23552449 GCCAGGGGCTCTCAGACCTTTGG + Intergenic
1065867981 10:29930153-29930175 GCCAGGGGCTCTCGGGCCTTCGG - Intergenic
1067169402 10:43894117-43894139 GCCAGGAGCTCTCAGGCCTTTGG - Intergenic
1067406131 10:46025157-46025179 CCCCTGGGTTCTCAGGCCTTTGG - Intronic
1068713117 10:60155875-60155897 GCCAGGGGCTCTCAGGCCTTTGG + Intronic
1069146083 10:64892979-64893001 GCTGGGGGCTCTCAGGCCTTTGG + Intergenic
1069371964 10:67757663-67757685 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1070737554 10:78874334-78874356 GCCAGGGGCTCTCGGGCCTTCGG + Intergenic
1070940395 10:80340192-80340214 CACTGGGCCTTTCAGACTTTGGG - Intronic
1071249355 10:83801235-83801257 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1071251947 10:83827565-83827587 GCCAAGGGCTCTCAGGCCTTCGG + Intergenic
1071281277 10:84106297-84106319 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1071374293 10:84986860-84986882 TCCAGGGACTCTCAGGCCTTTGG - Intergenic
1071719696 10:88131062-88131084 GCCTGGGACTCTCTGGCTTTAGG - Intergenic
1072958138 10:99904955-99904977 TCCTGGGGCTCTCAGGTGGTTGG - Intronic
1073101129 10:101007254-101007276 CTTTGGGGCCCTCAGCCTTTGGG - Exonic
1073323824 10:102631161-102631183 CCCTGGGCCTCCCAGCCTTCAGG + Exonic
1074184906 10:111092785-111092807 GCCAGGGGCGCTCAGGCCTTGGG - Intergenic
1074510349 10:114105930-114105952 GCCAGGGGCTTTCAGGCCTTTGG + Intergenic
1074531170 10:114299922-114299944 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
1074595897 10:114866738-114866760 CCCTGGGGCTCACACCATTTGGG - Intronic
1074878041 10:117629837-117629859 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1075210035 10:120483181-120483203 GCCAGGGGCTCTCAGACATTTGG + Intronic
1075439439 10:122467689-122467711 CCCTGGGGCTCCAAGGCCTTTGG + Intronic
1075585926 10:123658193-123658215 GCCAGGGGCTCTCAGACCTTTGG - Intergenic
1076407249 10:130220780-130220802 CCCCGTGGCTAGCAGGCTTTGGG - Intergenic
1076501382 10:130939104-130939126 GCCAGGGGCTCTCGGGCCTTCGG - Intergenic
1076533813 10:131163090-131163112 GCTAGTGGCTCTCAGGCTTTGGG + Intronic
1076558881 10:131348087-131348109 GGCAGGGGCTCTCAGGCTGTAGG - Intergenic
1076694163 10:132239122-132239144 GCCTGTGGCTCTCAGGATTGTGG - Intronic
1076718508 10:132381319-132381341 GCCAGGGGCTCTCGGGCCTTCGG + Intergenic
1077556018 11:3226453-3226475 CCCTGGGGCTCCCAGTCTCAAGG + Intergenic
1078025070 11:7687447-7687469 GCCTGAAGCTCTCAGGCTTCAGG - Intergenic
1078570127 11:12450707-12450729 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
1078925189 11:15868506-15868528 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1078932882 11:15926460-15926482 GCTGGGGGCTCTCAGGCCTTTGG + Intergenic
1079383916 11:19962108-19962130 CCCTGGGTCTCTCAGCCTATTGG + Intronic
1079447000 11:20566648-20566670 GCCAGGGCCTCTCAGGCCTTTGG + Intergenic
1079948632 11:26773889-26773911 GCCAGGGGCTCCCAGGCCTTTGG - Intergenic
1080876862 11:36282915-36282937 CCCAGTGGCTCTCAGTCTTTTGG - Intronic
1081052488 11:38361784-38361806 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1081291051 11:41326306-41326328 GCCAGGGGCTCTCAGGCCTTTGG + Intronic
1081379874 11:42401157-42401179 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1083083580 11:60119126-60119148 GCCAGGGGCTCGCAGGCCTTCGG - Intergenic
1083529956 11:63411091-63411113 GTCAGGGGCTCTCAGGCTTTTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085035888 11:73299800-73299822 CCCTGAGGCTCTCAAGCTGCTGG - Intergenic
1085236906 11:75022258-75022280 CCCAGGAACTCTCAGGCTCTTGG - Intergenic
1085386537 11:76161233-76161255 GCCGGGGTCTCTCAGGCTTGGGG + Intergenic
1085393110 11:76192665-76192687 CCCTTGGGCTCAGAGGCTTGGGG + Intronic
1085998140 11:81947361-81947383 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1086967066 11:93039910-93039932 CCCAGGGGCTTTCAGGCCTTTGG + Intergenic
1087366952 11:97232103-97232125 CCCAGGGGCTCTCGGGCCTTCGG + Intergenic
1087415563 11:97851068-97851090 GCCAGGGGCTCTCAGGTCTTTGG + Intergenic
1087567997 11:99887663-99887685 GCCAGGGGCTTTCAGGCCTTCGG - Intronic
1088212621 11:107473401-107473423 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1091635836 12:2195886-2195908 CCCTGGAGATCCCAGCCTTTGGG + Intronic
1094403243 12:30085502-30085524 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1094523199 12:31214900-31214922 TCCAGGGGCTCTTGGGCTTTCGG - Intergenic
1094617591 12:32049718-32049740 CCCTGGAGTTCTCAGGCCTTTGG + Intergenic
1094679145 12:32652181-32652203 GCCAGGGGTTCTCAGGCCTTTGG + Intergenic
1096101359 12:48972193-48972215 CCCGGGTGCGCTCAGGCTGTGGG - Intergenic
1096457113 12:51796750-51796772 GCCAGGGGCTCTCTGGCCTTTGG - Intronic
1096655882 12:53091862-53091884 CTCTGGGCCTCTCAGACTATTGG + Intergenic
1096735360 12:53649175-53649197 CCCGGGGGCTCTCGGGCCTTTGG - Intronic
1096906167 12:54937777-54937799 GCCGGGGGCTCTCGGGCCTTTGG + Intergenic
1097179296 12:57162177-57162199 CTCTGGGGCTCCCAGGCTAATGG + Intronic
1097183741 12:57185325-57185347 CCCTGGGTCTCTCGGGCCATCGG - Intronic
1097314369 12:58156136-58156158 TCCTTGGGTTCTCAGGCTTTGGG - Intergenic
1097516047 12:60607873-60607895 GCTGGTGGCTCTCAGGCTTTGGG + Intergenic
1098670624 12:73225771-73225793 ACCTGGGATTCTCAGGCCTTTGG - Intergenic
1099400915 12:82203077-82203099 GCCAGGGGTTCTCAGGCCTTTGG - Intergenic
1099719888 12:86347004-86347026 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
1099821718 12:87719759-87719781 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
1100148109 12:91701922-91701944 ACCTGATGCTCTCTGGCTTTGGG + Intergenic
1100203764 12:92326409-92326431 GCCAGGGGCTCTCAGACCTTTGG - Intergenic
1100265011 12:92967279-92967301 GCCAGGGGCTCTCAGGCTTTCGG + Intergenic
1100457994 12:94771047-94771069 CTCTTGGGCTCTCAGGCACTTGG + Intergenic
1100756037 12:97751769-97751791 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1100890781 12:99123625-99123647 GCCAGGGGCTCTCGGGCCTTAGG - Intronic
1101192632 12:102351004-102351026 GCCAGGGGCTCTGAGGCCTTTGG - Intergenic
1101241630 12:102844794-102844816 CCCAGGGGTTCTCAGGCCTTTGG + Intronic
1101275047 12:103190167-103190189 CCCAGAGGCTCTCAGGCCCTTGG - Intergenic
1101713856 12:107293353-107293375 GCCAGGGGCTCTCAGGCTTTTGG + Intergenic
1101960814 12:109248484-109248506 GCCAGGGGCCCTCAGGCCTTTGG - Intronic
1102088066 12:110160352-110160374 TCCTGGGGCTCTAGGCCTTTTGG - Intronic
1102717871 12:114989819-114989841 GCCAGGGCCTCTCAGGCCTTTGG - Intergenic
1104073719 12:125371030-125371052 CCCAGGAGCTCTCAGGCCTCTGG - Intronic
1104261032 12:127182226-127182248 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1104532093 12:129581506-129581528 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
1106262050 13:28076516-28076538 TCTGGGGGCTCTCAGGCCTTTGG - Intronic
1106446664 13:29839343-29839365 CCCTTGTGCTCTCAGCATTTGGG - Intronic
1106945282 13:34820677-34820699 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1107012065 13:35679510-35679532 TCCTGCGGTTCTCAGGCCTTCGG - Intergenic
1107175533 13:37394621-37394643 CCCTGTTGCCCTCAGGCTCTCGG + Intergenic
1107385582 13:39904938-39904960 GCCAGGGGCTCTCGGGCCTTCGG - Intergenic
1108098047 13:46925130-46925152 GCCAGGGGCTCTTGGGCTTTTGG + Intergenic
1108199173 13:48025709-48025731 CCCATGGGCTCTTGGGCTTTTGG + Intergenic
1108244023 13:48497232-48497254 CCCTGGGGCACTCAAACATTTGG - Intronic
1108466489 13:50721243-50721265 GCCAGGGGCTCTCGGGCCTTCGG + Intronic
1108882835 13:55142263-55142285 CCCAAGGGCTCTCTGGCCTTCGG + Intergenic
1109333257 13:60958507-60958529 GCCAGGGACTCTCAGGCCTTTGG + Intergenic
1109536125 13:63722108-63722130 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1109539975 13:63764178-63764200 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1109565109 13:64102942-64102964 GCCAGGGGCTCTCGGGTTTTTGG + Intergenic
1110168271 13:72469642-72469664 GCCTGGGACTCTCAGGCCTTCGG + Intergenic
1110363082 13:74650037-74650059 GCCAGGGGCTTTCAGGCCTTTGG + Intergenic
1110409516 13:75188869-75188891 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1110409755 13:75191302-75191324 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1110663551 13:78088197-78088219 CCCTGGGGATCTCACATTTTAGG + Intergenic
1110760148 13:79222410-79222432 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1111182429 13:84686683-84686705 TCCAGGGGTTCTCAGGCCTTTGG + Intergenic
1111271741 13:85895718-85895740 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1111441182 13:88284389-88284411 ACCAGGGGCTCTCAGGTCTTTGG + Intergenic
1111657090 13:91167345-91167367 CCCAGGCTCTCCCAGGCTTTGGG + Intergenic
1111695775 13:91621936-91621958 CGAGGGGGCTCTCAGGCCTTCGG - Intronic
1111786215 13:92789929-92789951 GCCAAGGGCTGTCAGGCTTTTGG - Intronic
1111982301 13:95029867-95029889 CTCTGAGGCTCACAGGCCTTGGG + Intronic
1112142517 13:96661049-96661071 TTCTGGGGCTCTTAGGCCTTTGG + Intronic
1112238213 13:97655466-97655488 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1112832489 13:103470971-103470993 CCCAGGGGCTCTCGGACCTTTGG - Intergenic
1113068311 13:106393649-106393671 CCCAGGGGCCCTCAGGCCTTCGG + Intergenic
1113355326 13:109574178-109574200 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1113447338 13:110379520-110379542 CAGTGGGGCTCACAGACTTTTGG + Intronic
1113505871 13:110815465-110815487 GCCAGGTGCTCTAAGGCTTTGGG + Intergenic
1113610773 13:111643555-111643577 CCCTTGGGCTCTGAAGCTTGTGG + Intronic
1113714421 13:112493070-112493092 CCCTGAGACGCTCTGGCTTTGGG + Intronic
1114038474 14:18652968-18652990 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1114120147 14:19662075-19662097 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
1114388212 14:22278026-22278048 CCCCTGGGTTCTCAGGCTTTTGG - Intergenic
1115807186 14:37064239-37064261 CCCTTGGGTTCTCAGGCCTTTGG + Intronic
1116122677 14:40740908-40740930 GCCAAGGGCTCTCAGGCCTTTGG - Intergenic
1116248724 14:42454726-42454748 CCAGGGGGATCTCAGGCCTTTGG + Intergenic
1116307848 14:43281594-43281616 CCCAGGGGCCCTCAGGCCTTTGG - Intergenic
1116414577 14:44665171-44665193 GCTAGGGGCTCTCAGGCCTTTGG + Intergenic
1117001700 14:51377043-51377065 GCCAGGGGCTTTCAGGCCTTTGG + Intergenic
1117001814 14:51377822-51377844 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1117222079 14:53616511-53616533 GCCAAGGGCTCTCTGGCTTTTGG - Intergenic
1117709725 14:58514288-58514310 CTCTGGAGCTCTCAGGACTTTGG + Intronic
1119420746 14:74506453-74506475 TCCTGAGGCTCTGAGGCTTGAGG + Intronic
1119627889 14:76197547-76197569 CCATGGGGCACTCAGGTTGTGGG - Intronic
1119774532 14:77240222-77240244 CCCGGGGGCTTTCAGGCTTGGGG - Intronic
1120236898 14:81903123-81903145 CCCTGGTGAACTCAGGCTGTAGG - Intergenic
1120760923 14:88284515-88284537 GCCAGGGGCTCTCAGACTTTTGG - Intronic
1120852690 14:89185713-89185735 CCCTGAGGCTCTCAGGATGAGGG + Intronic
1121082538 14:91119948-91119970 GCCAGGGGCTCTCAGGGCTTTGG + Intronic
1121100065 14:91244453-91244475 TCCTGGGGCCCTGAGGCTCTAGG - Exonic
1121521672 14:94590338-94590360 CCCTGGGGCTGTGTGGGTTTAGG - Intronic
1121615574 14:95311498-95311520 CCCTGGGGTTGTTAGGATTTGGG - Intronic
1121897973 14:97666162-97666184 ACCACGGGCTCTCAGGCCTTTGG + Intergenic
1122371956 14:101233921-101233943 CTCTGGGGCTCTGGGGCTGTGGG - Intergenic
1122371959 14:101233929-101233951 CTCTGGGGCTCTGGGGCTCTGGG - Intergenic
1122660596 14:103292403-103292425 CTCTGGGGCTCTCAGTCTATGGG + Intergenic
1122660635 14:103292676-103292698 CTCTGGGGCTCTCAGTCTATGGG + Intergenic
1122875530 14:104662612-104662634 CCCTCCGGCTCTCAGGGCTTCGG + Intergenic
1123184610 14:106504935-106504957 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1202828892 14_GL000009v2_random:4688-4710 CCCCGAGGCTCTCAGGCCCTCGG + Intergenic
1123931006 15:25171651-25171673 CCCTGGGACTCGCTGGCTTTGGG + Intergenic
1123934697 15:25188460-25188482 CCCTGGGACTCGTGGGCTTTGGG + Intergenic
1123935969 15:25194257-25194279 CCCTGGGACTCATGGGCTTTGGG + Intergenic
1123941257 15:25217688-25217710 CCCTGGGACTCATGGGCTTTGGG + Intergenic
1123945103 15:25235131-25235153 CCCTGGGACTCGTGGGCTTTGGG + Intergenic
1123945522 15:25237015-25237037 CCCTGGGACTTTTGGGCTTTGGG + Intergenic
1123946377 15:25240785-25240807 CCCTGGGACTCGTGGGCTTTGGG + Intergenic
1123947619 15:25246402-25246424 CCCTGGGACTCGTGGGCTTTGGG + Intergenic
1127574166 15:60273673-60273695 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1128013848 15:64324540-64324562 GCCAGAGGCTCTCAGGCCTTCGG + Intronic
1128145583 15:65330822-65330844 CCAGAGGGCTGTCAGGCTTTTGG - Intronic
1128497279 15:68205729-68205751 CACCGGGGCTCGCAGGCTTGGGG + Intronic
1128977656 15:72165289-72165311 GCCTGGAGCTCTGAGGCTTCTGG - Intronic
1129069747 15:72940783-72940805 CCCTGGGGCCTTCTTGCTTTGGG + Intergenic
1129077305 15:73008130-73008152 TCCCAGGGCTCTCAGGCCTTTGG - Intergenic
1130066404 15:80608513-80608535 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1130380807 15:83371093-83371115 CCCTAGGTCTCCCAGGCCTTAGG + Intergenic
1130391421 15:83459034-83459056 GCCAGGGGCTCTCGGGCCTTCGG - Intronic
1131074217 15:89484826-89484848 CCCTTGGGCTATCAGCATTTGGG + Intronic
1131701261 15:94938617-94938639 TCCATGGGCTCTCAGGCCTTTGG - Intergenic
1131753959 15:95540302-95540324 GCAAGGGGCTCTCAGGCCTTCGG - Intergenic
1131901806 15:97095720-97095742 GCCAGGGGCTCTCAGGCCCTTGG + Intergenic
1132025643 15:98402471-98402493 GCCAGGGACTCTCAGGCCTTTGG - Intergenic
1132573149 16:652747-652769 CCCGGGGGCTCTCAGGGTCACGG + Intronic
1132861150 16:2072414-2072436 CCCAGAGGCTCGCAGTCTTTTGG - Intronic
1133379383 16:5317058-5317080 CTCCTGGGCTCTCAGGCCTTTGG + Intergenic
1133643077 16:7736691-7736713 GCTAGGGGCTCTCAGGCCTTTGG - Intergenic
1134374895 16:13662639-13662661 GCCAGGGGCTCTCAAGCCTTTGG + Intergenic
1134412266 16:14012824-14012846 CCCTGGAGCTTTCAGCCTGTAGG + Intergenic
1134504888 16:14797020-14797042 GCCAGGGGCTCTCAAGCCTTTGG - Intronic
1134575685 16:15331889-15331911 GCCAGGGGCTCTCAAGCCTTTGG + Intergenic
1134726760 16:16424613-16424635 GCCAGGGGCTCTCAAGCCTTTGG - Intergenic
1134940674 16:18287250-18287272 GCCAGGGGCTCTCAAGCCTTTGG + Intergenic
1135206469 16:20488865-20488887 CCACGGGGATCTCAGACTTTTGG - Intergenic
1135212416 16:20534771-20534793 CCACGGGGATCTCAGACTTTTGG + Intergenic
1135253661 16:20922907-20922929 CCCTTGGGTTCTCAGGCCTGTGG - Intronic
1136019726 16:27432414-27432436 CCCTGGGGCTCTCTGCCCTGTGG + Intronic
1136182639 16:28564986-28565008 CTCAGGGGCTCTCAGGCCTTAGG - Intronic
1137543403 16:49380120-49380142 GCCAGGGGCTCTCGGGCTTTTGG + Intronic
1137687658 16:50397850-50397872 GCCAGGGGTTCTCAGGCCTTCGG - Intergenic
1137927009 16:52549184-52549206 CCCTAAGGCTCTCAGGAGTTAGG + Intergenic
1138094197 16:54199463-54199485 GCCTGGGGCTGGCAGGCTTGGGG + Intergenic
1138190873 16:55012983-55013005 TGCTAGGGCTCTCAGGCCTTGGG + Intergenic
1138718701 16:59053472-59053494 CCTGGGGGCTCTCAGACCTTTGG + Intergenic
1138789877 16:59890818-59890840 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
1138907047 16:61349541-61349563 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1138923843 16:61566834-61566856 ACCAGGGGCTCTCGGGCCTTTGG - Intergenic
1138970939 16:62141930-62141952 GCAAGGGGCTCTCAGGCCTTTGG - Intergenic
1138999366 16:62490482-62490504 CCTGGGGGCTCTCAGACCTTTGG + Intergenic
1139116748 16:63963525-63963547 GCCAGGGACTCTCAGGCCTTTGG + Intergenic
1139294024 16:65884455-65884477 CCCTGGGGCTCCCAGGCTTATGG - Intergenic
1139844652 16:69911544-69911566 CGGTGGGGCTCTCAGGTTTGGGG + Intronic
1140332157 16:74068737-74068759 CCCCTGGGTTCTCAGGCATTTGG + Intergenic
1141172521 16:81700384-81700406 CTCTGGGAGTCTCAGGCTTCTGG - Intronic
1141172529 16:81700424-81700446 CTCTGGGAGTCTCAGGCTTCTGG - Intronic
1141249573 16:82342909-82342931 GTCAGGGGCTCTCAGGCCTTTGG - Intergenic
1141267566 16:82510740-82510762 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1141878217 16:86840921-86840943 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1142030421 16:87835804-87835826 CCCCGGGGCCCCCAGGCTTCGGG + Intronic
1142048260 16:87940164-87940186 CCCCAGGGTTCTCAGGCCTTTGG - Intergenic
1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG + Intronic
1142953688 17:3505581-3505603 CCATGGGACTCTCAGGCTTCAGG - Intronic
1143026449 17:3944492-3944514 CCCTGGGGCTCTTGGTCTGTGGG - Intronic
1143464072 17:7123911-7123933 GCCAGGGGCCCTCAGGCCTTCGG + Intergenic
1143481225 17:7228412-7228434 CCCTGGGGCAGTGAGGCATTTGG + Intronic
1143650596 17:8261911-8261933 CCCTGGAGCCCCCAGGCTTCAGG + Intronic
1143729944 17:8875752-8875774 CACTGCGGGTCTCAGGGTTTGGG - Intergenic
1144071066 17:11671587-11671609 CTATGGGGCTCTCATGCTCTGGG - Intronic
1144089575 17:11842583-11842605 TCCAGGGGCTCTCAGGCCCTTGG - Intronic
1144191784 17:12853141-12853163 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
1144412376 17:15013605-15013627 CCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1144457511 17:15431126-15431148 CCCTGGTTCAGTCAGGCTTTAGG - Intergenic
1145206848 17:20989061-20989083 CTCTGGGGCTCCCAGCCTGTGGG + Intergenic
1146502103 17:33373003-33373025 CCCTGGGGTTCTGATGCTTTGGG + Intronic
1146571830 17:33959535-33959557 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
1146675659 17:34772241-34772263 AGCTGGGGCTCTCAGGCTCATGG - Intergenic
1147262076 17:39214548-39214570 CCCTGGGGCTGCCTGCCTTTGGG + Intronic
1148749317 17:49935537-49935559 CCCTGGGGGTCCCAGGTCTTTGG + Intergenic
1148912199 17:50949103-50949125 CCCAGTGGGTCTCAGCCTTTCGG - Intergenic
1148960431 17:51388004-51388026 GCCAGGGGCTATCAGGCCTTTGG - Intergenic
1149026278 17:52030849-52030871 ACCTGAGGCTCTCAGGTCTTTGG + Intronic
1149661814 17:58338126-58338148 CTCTGGGGCTCTGGGGCTCTGGG - Intergenic
1150110859 17:62498214-62498236 CCTTAGGGCTTTCAGGTTTTGGG + Intronic
1151029408 17:70718767-70718789 GCCAGGGGCTCTTGGGCTTTCGG + Intergenic
1151275065 17:73028021-73028043 CCAAGGGGCTCTCACCCTTTGGG - Intronic
1151368562 17:73632470-73632492 TCCAGGGGCTCTCAGACCTTTGG + Intronic
1151444990 17:74157631-74157653 GCCAGGGACTCTCAGGCCTTCGG + Intergenic
1151492178 17:74439337-74439359 CCCTGGGACTTTCAGGCTTCAGG - Intronic
1151499317 17:74478808-74478830 TCCTGTGGCGCCCAGGCTTTTGG + Intronic
1151554283 17:74838769-74838791 ACCTGGGGCTCTCTTGCTGTTGG - Exonic
1151571435 17:74927821-74927843 CCCTGTGGCTACCAGGCCTTGGG + Intronic
1151961401 17:77407809-77407831 CCCTGGTCCTCTCAGGCTCTGGG + Intronic
1151967454 17:77438845-77438867 CCCTGTGGATCTCAAGCTCTGGG + Intronic
1152046678 17:77941247-77941269 GCCGGGGGCTCTCAGGCCTTTGG + Intergenic
1152068520 17:78124233-78124255 CCCTGTGGCTGTCAGGCCTGAGG - Intronic
1152365781 17:79855588-79855610 CCCTGGGGCCCTCGGGACTTGGG + Intergenic
1152397744 17:80044920-80044942 CCCACTGGCTCTCAGTCTTTGGG + Intronic
1152535787 17:80949700-80949722 ACCTGGGGCTCTCACGCTTTCGG - Intronic
1152583430 17:81178974-81178996 CCCAGGGGCTCGCAGGCACTTGG - Intergenic
1152663530 17:81553891-81553913 TCCGGGGGCTGGCAGGCTTTTGG + Intronic
1153614009 18:6917508-6917530 CCGAGGGGCTCTCAGACTTTAGG + Intergenic
1153684887 18:7535852-7535874 ACCAGGGCCTCTCAGGCCTTTGG - Intergenic
1153717980 18:7869901-7869923 CACTGGGGCTCTTAGCCTTGAGG - Intronic
1153838825 18:8988380-8988402 CCCTGCAGCTCTCAGGCTCCTGG - Intergenic
1155551251 18:26967991-26968013 GCCAGGGGCTCTCAGGCCTTCGG + Intronic
1155775277 18:29753286-29753308 CCAAGGGGCTCTCGGGCCTTTGG + Intergenic
1155909086 18:31487839-31487861 CACTGGGACTCTCACTCTTTCGG + Intergenic
1155988209 18:32253091-32253113 CCATATCGCTCTCAGGCTTTTGG + Intronic
1156169877 18:34469771-34469793 GCCAGGGGCCCTCAGGCCTTCGG + Intergenic
1156260268 18:35439688-35439710 ACCTGGGGCTATCAGAATTTGGG + Intergenic
1156312918 18:35941119-35941141 CCCTGGGGCTGGCAGGCGTGTGG + Intergenic
1156987201 18:43362091-43362113 CCCTGGGGCCCTTGGGCCTTCGG - Intergenic
1157180879 18:45496935-45496957 GCCAGAGGCTCTCAGGCCTTTGG + Intronic
1157800515 18:50616646-50616668 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
1157918902 18:51696254-51696276 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1158025722 18:52894930-52894952 CCGTGGGGCACCCAGCCTTTTGG - Intronic
1158037383 18:53050000-53050022 GCCAGGCGCTCTCAGGCCTTTGG - Intronic
1158126018 18:54100319-54100341 CCCTGGGGTTCTTGGGCCTTTGG + Intergenic
1158446508 18:57526757-57526779 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
1158547092 18:58405696-58405718 CCCTGAGGCTCTCAGCCATGGGG + Intergenic
1158762821 18:60410819-60410841 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1158818105 18:61127260-61127282 GCCAGGGGCTCTCAGACCTTTGG - Intergenic
1159004972 18:63003445-63003467 ACCAGGGGCTCTCGGGCCTTTGG + Intergenic
1159269578 18:66131127-66131149 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
1159301754 18:66581674-66581696 CTGGGGGCCTCTCAGGCTTTTGG + Intronic
1159704416 18:71668738-71668760 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1160184840 18:76667880-76667902 CCCGGGGCCTCACAGGCTCTCGG + Intergenic
1160223845 18:76997370-76997392 CCCTGGGGCCCTGGGGCTTCTGG + Intronic
1160246159 18:77161826-77161848 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1160327818 18:77967126-77967148 CCCTGCTGCTCGCAGCCTTTGGG - Intergenic
1160660213 19:294655-294677 CCCTGGTGACCTCAGGCTCTGGG - Intergenic
1161362579 19:3859282-3859304 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
1161397382 19:4051974-4051996 GCCTCGGGCTCCCAGGCTTTTGG + Intronic
1161998852 19:7730852-7730874 CCCTGCGGCTCCCAGGCTCGGGG - Exonic
1162529096 19:11225309-11225331 CCCTGGGAATGTCAGTCTTTGGG + Intronic
1162853195 19:13447683-13447705 GCCAGGAGCTCTCAGGCCTTTGG - Intronic
1163817835 19:19477731-19477753 CCCAGGATCTCTCAGGCATTTGG + Intronic
1164040780 19:21490899-21490921 GCCTGGGCCTCTCATGTTTTGGG + Intronic
1164781589 19:30897353-30897375 CCCTGGGGCACTCTGGGGTTGGG + Intergenic
1165096263 19:33411465-33411487 CCCTGGGGGGTGCAGGCTTTTGG + Intronic
1165845113 19:38813023-38813045 TTCTGGGACTCTCAGGCTGTCGG + Exonic
1167520151 19:49950012-49950034 CCCTGAGGGGCCCAGGCTTTGGG - Exonic
1202643805 1_KI270706v1_random:123112-123134 CCCCGAGGCTCTCAGGCCCTCGG - Intergenic
925713273 2:6762184-6762206 GCCAGGGGCTCTCGGGCTGTTGG + Intergenic
925900242 2:8504070-8504092 GCCAGGGGCTCTCGGGCCTTCGG + Intergenic
926096016 2:10080733-10080755 CGCTAGGGGGCTCAGGCTTTGGG - Intronic
926388562 2:12363199-12363221 TCCAGGGCCTCTCAGGCCTTCGG + Intergenic
926421971 2:12708646-12708668 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
926563558 2:14444713-14444735 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
926577781 2:14601231-14601253 GCCAGGGGCTCTCTGGCCTTCGG + Intergenic
926606572 2:14904346-14904368 GCCAGGGGCTCTCGGGCCTTGGG - Intergenic
926704957 2:15830485-15830507 CCCGTGGGTTCTCAGGCCTTCGG + Intergenic
927006356 2:18853421-18853443 CCCAGGTACTCCCAGGCTTTGGG + Intergenic
927438417 2:23090347-23090369 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
927517817 2:23682317-23682339 CCCTGAGGCTCTGAGGATGTGGG + Intronic
928172690 2:29013523-29013545 GCCAGGGGCTCTCGGACTTTTGG - Intronic
928299514 2:30112945-30112967 GCCTGGGGCTCTCAGGCCTTCGG + Intergenic
928334395 2:30383846-30383868 CCCTAGGGATTTCAGGCTTCAGG - Intergenic
928415979 2:31092093-31092115 GCCTGGAGCTCTCAGGACTTTGG + Intronic
928865950 2:35918109-35918131 GCCAGGGGCTCTCGGGCTCTTGG - Intergenic
929059890 2:37913441-37913463 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
929278171 2:40048050-40048072 CCTTGAGGCTCTGAGGCTTCAGG + Intergenic
930940690 2:57010910-57010932 CCCTCTGGTTCTCAGGCCTTTGG - Intergenic
931707867 2:64962453-64962475 GCCAGGGGCTCTCAGGTCTTAGG - Intergenic
932578126 2:72973825-72973847 CCTTGGAGCTGCCAGGCTTTCGG + Intronic
933446228 2:82383246-82383268 GCCAGGGGCTCTCATGCCTTTGG - Intergenic
934013278 2:87849867-87849889 ACGTGGGGCTTTCATGCTTTTGG + Intergenic
934506239 2:94897022-94897044 CCCCGAGGCTCTCAGGCCCTCGG - Intergenic
935254694 2:101299271-101299293 CACTGTGGATCTCAAGCTTTGGG + Intronic
936225100 2:110641779-110641801 CCCAGGGGTTGGCAGGCTTTTGG + Exonic
936790870 2:116150170-116150192 CCCGGGAGTTCTCAGGCCTTTGG - Intergenic
937493999 2:122398853-122398875 TCCCCAGGCTCTCAGGCTTTTGG + Intergenic
937620244 2:123977012-123977034 CCAGGGGGCTCTCAGGCATTTGG - Intergenic
937666534 2:124494271-124494293 CCCTTGGGTTCTCAGGCCTTTGG - Intronic
937799894 2:126071131-126071153 CCCAGGGGCTCTAGGGCCTTCGG + Intergenic
937880607 2:126861715-126861737 CCCTCAGGTTCTCAGGCCTTTGG - Intergenic
938310321 2:130285123-130285145 CTCTGGGGCTCCCAGGCTTCGGG + Intergenic
938444610 2:131367246-131367268 CCCTGGGGCTCCCAGGCTTCGGG - Intergenic
939265553 2:139867939-139867961 GCCAGGGGTTCTCGGGCTTTTGG + Intergenic
939336794 2:140839606-140839628 GCAAGGGGCTCTCAGGCCTTTGG + Intronic
939806565 2:146781136-146781158 GCCAGGGGCTCTCGGGCCTTCGG + Intergenic
940319238 2:152358207-152358229 GCCAGGGGCTCTCGGGCATTTGG + Intronic
941034838 2:160557029-160557051 CTCTGGGCCTCTCTGGATTTGGG - Intergenic
941039155 2:160600784-160600806 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
941560020 2:167033275-167033297 CACTGGGCCTGTCAGGGTTTGGG + Intronic
941852127 2:170194848-170194870 GCCAGGGACTCTCAGGCCTTTGG - Intronic
942292661 2:174487309-174487331 CCCTGGGGCTCCGAGGCTGGAGG - Intergenic
943076832 2:183205981-183206003 GCCTGGGACTCTGAGGCCTTCGG + Intergenic
943143318 2:184010480-184010502 CCCTGGGGCTCTTGGGACTTTGG + Intergenic
943301704 2:186211032-186211054 TCCAGGGGCTCTCGGGCCTTTGG - Intergenic
943784064 2:191857300-191857322 GCCAGGGGTTCTCAGACTTTGGG - Intergenic
943994277 2:194739045-194739067 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
944034533 2:195277991-195278013 GCCAGGGGATCTCAGGCCTTTGG - Intergenic
944454644 2:199880355-199880377 GCCTCGGGCTCTCAGGGTGTTGG - Intergenic
944713236 2:202354687-202354709 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
944877491 2:203976878-203976900 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
944962477 2:204890711-204890733 CCCTGTGGCTAGCAGGCCTTAGG - Intronic
944968581 2:204965184-204965206 CACTGGGGCTCTCAATCTTGTGG - Exonic
945243363 2:207696953-207696975 GCCAGGGGCTCTCGGGCTTTCGG - Intergenic
945783732 2:214207931-214207953 GCCAGAGGCTCTCAGGCCTTCGG + Intronic
946569736 2:221010477-221010499 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
946643087 2:221804993-221805015 CCCAGGGGCTCTTGGGCCTTTGG - Intergenic
946790488 2:223296248-223296270 GCCTGGGGCTCTCGGGCCTTCGG + Intergenic
947030596 2:225788651-225788673 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
947439374 2:230104987-230105009 GCCAGGGTCTCTCAGGCCTTTGG - Intergenic
948348553 2:237319677-237319699 GCCAGGGGCTCTCGGGCCTTCGG + Intergenic
1169510840 20:6262149-6262171 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1169774689 20:9239812-9239834 GCCGGGGGCTCTGAGGCCTTTGG - Intronic
1169967618 20:11235387-11235409 CCCTCTGGTTCTCAGGCTCTTGG - Intergenic
1170004076 20:11646757-11646779 CCCTCGGCCTCTCAGGCTTGGGG + Intergenic
1170062487 20:12273600-12273622 CCATGTCGCTATCAGGCTTTTGG + Intergenic
1170503825 20:17003528-17003550 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1170631875 20:18073045-18073067 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1171234451 20:23512809-23512831 CCCTGGGCCTCTGAGGCTCTGGG - Intergenic
1171300440 20:24055261-24055283 CCCTGGTGGTCTCTGGCTTGGGG + Intergenic
1171455493 20:25269755-25269777 CCCTGGGGCTGTCAGGAGATGGG - Intronic
1173404301 20:42751760-42751782 CCCAGGGGCTCTCGGGCCTTTGG + Intronic
1174002410 20:47384416-47384438 CCCTGGGGCTCTCAGGGGGCTGG + Intergenic
1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG + Intergenic
1174527591 20:51186044-51186066 GCCTGGGCCTCTCAGTCTTCTGG - Intergenic
1174824044 20:53753015-53753037 CTCTGGGGCTTTCAGGCTACAGG + Intergenic
1174853492 20:54019826-54019848 GCCAGGGGCTCTCAGGCCTTTGG + Intronic
1174956095 20:55100295-55100317 GCCAGGGGCTCTCAGGACTTTGG - Intergenic
1175839301 20:62016561-62016583 GCCAGGGGTTCTCAGGCCTTTGG + Intronic
1176608074 21:8849516-8849538 CCCCGAGGCTCTCAGGCCCTCGG + Intergenic
1177232471 21:18340366-18340388 GCCAGAGGCTCTCAGGCCTTTGG + Intronic
1177395937 21:20536367-20536389 GCCAGGGCCTCTCAGGCGTTGGG - Intergenic
1177533057 21:22388355-22388377 ACCAAGGGCTCTCAGGCCTTTGG + Intergenic
1178463558 21:32825713-32825735 TCCTCTGGGTCTCAGGCTTTTGG - Intergenic
1178513292 21:33225525-33225547 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1179282850 21:39949888-39949910 GCCAGGAGCTCTCAGGCCTTTGG + Intergenic
1179638605 21:42731895-42731917 CCCTGGGGCTCTCTGGGCCTGGG - Exonic
1179710054 21:43208130-43208152 CCCTGGTCCTCCCAGGCTTAGGG - Intergenic
1179770248 21:43609938-43609960 CCCTGGAGCTCTGTGCCTTTGGG - Intronic
1180358166 22:11859321-11859343 CCCCGAGGCTCTCAGGCCCTCGG + Intergenic
1180380100 22:12133009-12133031 CCCCGAGGCTCTCAGGCCCTCGG - Intergenic
1180462598 22:15580010-15580032 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1180949161 22:19713549-19713571 CTTTGGGGCTGTCAGGCTTGCGG - Intergenic
1181456579 22:23063405-23063427 CCCTGCAGCTTTGAGGCTTTGGG + Intronic
1182421517 22:30250815-30250837 CCCTGGGGCTCTCAGGAGAGAGG + Intergenic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1183082937 22:35468411-35468433 CACTGAGGCTCTGTGGCTTTGGG + Intergenic
1183093918 22:35541127-35541149 GCCTGGGGCTCTCGGGCTGGGGG - Exonic
1183096180 22:35553624-35553646 CCCTGGGGCCTTCAGGGCTTTGG + Exonic
1183162029 22:36120905-36120927 GCCAGGGGCTCTCAGGCCTCCGG - Intergenic
1183749127 22:39709353-39709375 CCCCGGGGCCTTGAGGCTTTTGG + Intergenic
1184583234 22:45430842-45430864 CCCTGGGGTTCTTTGGCTCTGGG + Intronic
1184938768 22:47745203-47745225 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1185094378 22:48798418-48798440 CTCTGGGGCGCGCTGGCTTTGGG - Intronic
949307667 3:2661255-2661277 CCTTGGGGCTGCCTGGCTTTGGG - Intronic
950733328 3:14981755-14981777 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
950807660 3:15620958-15620980 CCCCTGGGTTCTCAGGCCTTCGG - Intronic
950888155 3:16378702-16378724 CCCTGGTGCTCTCAGGCTTAGGG + Intronic
951331677 3:21377061-21377083 GCCAGTGGCTCTCAGGCCTTTGG - Intergenic
951400699 3:22228923-22228945 CCCAGGAGCTCTTAGGCCTTCGG + Intronic
951470592 3:23052038-23052060 CCCTGGAGCTCTCATAGTTTGGG - Intergenic
952035414 3:29195555-29195577 CCTGGGAGCTCTCAGGCCTTTGG - Intergenic
952162587 3:30708997-30709019 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
953288865 3:41641616-41641638 GCCTGGGTCTTCCAGGCTTTAGG - Intronic
953681302 3:45040312-45040334 ACCTGGGGGTCTAAGGCATTAGG - Intergenic
954865267 3:53723602-53723624 CCCTGGGGATCTCTGTGTTTCGG + Exonic
955032234 3:55232606-55232628 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
955489932 3:59471794-59471816 GCCAAGGGCTCTCAGGCCTTTGG - Intergenic
955499081 3:59566186-59566208 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
956314118 3:67915040-67915062 GCCAGAGGCTCTCAGGCCTTTGG - Intergenic
957041851 3:75341770-75341792 CCCTGTGGGTCTCAGCCATTGGG + Intergenic
957242376 3:77675367-77675389 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
957663014 3:83185187-83185209 ACCAGGGCCTCTCAGGCTGTGGG - Intergenic
958586919 3:96098993-96099015 GCTTGGGGCTCTCGGGCCTTTGG + Intergenic
958825260 3:99022203-99022225 GCCAAGGGCTCTCAGGCCTTTGG - Intergenic
958877576 3:99633440-99633462 CCTAGGGGCTCTCGGGCCTTCGG + Intergenic
958879542 3:99654038-99654060 GCCAGGGGCTCTCAGGCCCTCGG - Intronic
958981539 3:100726132-100726154 CCAGGGGACTCTCAGGCCTTTGG - Intronic
959282488 3:104362673-104362695 GCCAGGGGCTCTCGGGCCTTGGG - Intergenic
959310161 3:104725963-104725985 GCCAGGTGCTCTCAGGCCTTTGG - Intergenic
959339627 3:105112623-105112645 GCCAGGGACTCTCAGGCCTTTGG - Intergenic
959527042 3:107388926-107388948 CCTTGGGGCTCACAGGCCTTGGG - Intergenic
961046569 3:123712566-123712588 CCCTGTGGGTCTCAGCCATTGGG + Intronic
961710633 3:128825324-128825346 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
961733427 3:128984524-128984546 CCGGGGGGCTCTCAGGCCTTCGG + Intronic
961961285 3:130857953-130857975 ACCAGGGGCTCTCAGGCCTTTGG - Intronic
961999880 3:131284815-131284837 GCCAGGGGCTCTCAAGCCTTCGG + Intronic
963007630 3:140740819-140740841 TCCTGGGCCTCTCAGGTTCTGGG - Intergenic
963488820 3:145972720-145972742 TCCAGGGGCTCTCAGGCCTTGGG + Intergenic
963661753 3:148135123-148135145 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
963893285 3:150659455-150659477 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
965071333 3:163918351-163918373 TCTAGGGGCTCTCAGGCCTTTGG + Intergenic
965269792 3:166600592-166600614 ACCAGGGGCTCTCGGGCATTTGG - Intergenic
966107205 3:176350641-176350663 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
966287227 3:178312127-178312149 GCCAGGGCCTCTCAGGCCTTTGG + Intergenic
967035378 3:185645362-185645384 CCCTGGGGTTCTCAGGGCCTCGG + Exonic
967216188 3:187212542-187212564 CCCTGGGGCTTTCAGAGCTTTGG + Intergenic
967612901 3:191528939-191528961 GACAGGGGCTCTCAGGCCTTTGG - Intergenic
967742527 3:193018907-193018929 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
967745232 3:193047636-193047658 TCCAGAGGCTCTCAGGCCTTTGG + Intergenic
967764037 3:193257940-193257962 GCCAGGGACTCTCAGGCCTTTGG + Intronic
968565048 4:1307686-1307708 CCCCAGGGTTCTCAGGCCTTTGG - Intronic
969006644 4:4025525-4025547 CCGTGGGACACTCAGGCTTGTGG + Intergenic
969148578 4:5146328-5146350 GCCAGGGGCTCTCAGGCTTTCGG - Intronic
969244559 4:5924060-5924082 GCCAGGGGCTCTCGGGCCTTGGG + Intronic
969284313 4:6193210-6193232 GCCAGGGGCTCTAAGGCCTTTGG + Intronic
969504354 4:7574959-7574981 CAATGGGGCTCTCAGGCATCTGG - Intronic
969643481 4:8412889-8412911 CCCTGGGGCTCTCAGTGCTGTGG - Intronic
969991712 4:11271264-11271286 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
970071616 4:12165689-12165711 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
970101039 4:12523361-12523383 CCCTTGGGCTCTCAGGCTTGTGG - Intergenic
970191415 4:13522786-13522808 CCCTGGGGCTCTGAGCGCTTTGG - Intergenic
970415684 4:15854675-15854697 GTCAGGGGCTCTCAGGCCTTTGG - Intergenic
970624501 4:17861944-17861966 CCCTATTGCTATCAGGCTTTTGG + Intronic
970831634 4:20346731-20346753 GTCAGGGGCTCTCAGGCCTTTGG - Intronic
971012719 4:22456545-22456567 TCCTGGGGCTTTCATGCCTTCGG + Intronic
971072145 4:23106129-23106151 CTCTGGCTTTCTCAGGCTTTTGG + Intergenic
971078852 4:23183736-23183758 GCTGGGGGCTCTCAGGCTTTTGG - Intergenic
971189155 4:24410827-24410849 GCCAGGGGCTCCCAGGCCTTTGG + Intergenic
971428570 4:26540126-26540148 CCCTGGGGTTCTCAGGCCTTTGG - Intergenic
971790738 4:31167275-31167297 GCCAGGGGCTCTCAGACCTTCGG - Intergenic
972073778 4:35057286-35057308 GCCAGAGGCTCTCAGGCCTTTGG + Intergenic
972116820 4:35646496-35646518 GCCAGGGGCTCTCAGGCCTCTGG - Intergenic
972301142 4:37786810-37786832 CCATGCCGCTATCAGGCTTTTGG - Intergenic
972643108 4:40943278-40943300 CCCTGGTGTTCTCTGGCTATAGG + Intronic
972942810 4:44217820-44217842 GCCAGGGGCTCTCAGGCCTTTGG + Intronic
973070238 4:45849532-45849554 CCTAGGGGTTCTCAGGCCTTTGG + Intergenic
975386398 4:73764835-73764857 GCCAGAGGCTCTCAGGCCTTTGG - Intergenic
975403892 4:73968009-73968031 GCCTGGGGATCAAAGGCTTTTGG - Intergenic
975893043 4:79051960-79051982 TCCTGGGGCTGGCTGGCTTTTGG + Intergenic
975934509 4:79562163-79562185 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
977001689 4:91512426-91512448 GCCAAGGGCTCTCAGGCCTTTGG + Intronic
977235918 4:94507039-94507061 TGCTGGGGCTCTTGGGCTTTTGG + Intronic
977758137 4:100698187-100698209 GCCAGGGGCTCTCGGGCCTTCGG - Intronic
979051999 4:115946315-115946337 CTCAGGGGCTCTCAGGCCTTTGG + Intergenic
979106944 4:116701246-116701268 CCAAGGGACTCTCAGGCCTTTGG - Intergenic
979810185 4:125027146-125027168 GCCAGGGGCACTCAGGCCTTTGG + Intergenic
979888246 4:126059462-126059484 CCCAGAGGCTCTCAGACCTTTGG - Intergenic
980494881 4:133577691-133577713 CCATGTTGCTATCAGGCTTTTGG - Intergenic
980887523 4:138779462-138779484 CCCAAAGGCTCTCAGGCCTTCGG + Intergenic
981220359 4:142225280-142225302 GCCAGGGGCTCTCTGGCCTTTGG + Intronic
981727364 4:147861937-147861959 CCCAGCGGCTCCCAGGCTTCAGG + Intronic
981885200 4:149665966-149665988 GCCAGGGTCTCTCAGGCCTTTGG + Intergenic
982370044 4:154624645-154624667 TGCCGGGGCTCTCAGGCCTTAGG - Intergenic
982530923 4:156542691-156542713 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
982550410 4:156791039-156791061 GGCTGCGGCTCTCTGGCTTTGGG + Intronic
982597447 4:157404377-157404399 GCAAGGGGCTCTCAGGCCTTTGG - Intergenic
982654305 4:158128189-158128211 TCCTGGAGCTCTGAGGATTTAGG + Intronic
982656155 4:158152123-158152145 GCCAGGGTCTCTCAGGCCTTTGG + Intronic
982797080 4:159659167-159659189 CCCTCAGGATCTCAGGCCTTTGG + Intergenic
983228415 4:165106703-165106725 GCCTGGGGCTCTCAGGCCTTCGG + Intronic
983727444 4:170946018-170946040 GCCAGGAGCTCTCAGGCCTTTGG - Intergenic
983797450 4:171882565-171882587 CCCGGGGGTTCTCGGGCCTTTGG - Intronic
984277289 4:177626304-177626326 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
984288806 4:177766833-177766855 CCCGGGGGCTCTGGGGCCTTCGG - Intronic
984436621 4:179718325-179718347 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
984732843 4:183084427-183084449 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
985370638 4:189282196-189282218 GCCAGGGGCTCTCAAGCCTTTGG + Intergenic
1202771174 4_GL000008v2_random:209044-209066 CCCCGAGGCTCTCAGGCCCTCGG - Intergenic
985522277 5:380961-380983 CCTGGGGGCTCTCAGGCCTTTGG - Intronic
985953556 5:3242710-3242732 CCCAGGGGATCTCAGGCCATTGG - Intergenic
986760712 5:10877276-10877298 GCTGGGGGCTCTCAGGCCTTTGG - Intergenic
987182029 5:15378112-15378134 GCCAGGGGCTCTTGGGCTTTTGG - Intergenic
987701008 5:21398337-21398359 GCCAGGGGCTCTCAAGCCTTCGG + Intergenic
987773496 5:22335985-22336007 CCATGTTGCTGTCAGGCTTTTGG - Intronic
987999909 5:25334766-25334788 GCCAGGGGGTCTCAGGCCTTTGG + Intergenic
988281063 5:29147985-29148007 TCCTCAGGCTCTCTGGCTTTTGG + Intergenic
988655792 5:33210176-33210198 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
989331654 5:40266905-40266927 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
990144447 5:52743222-52743244 CCTTGAGGGTCTCAGGGTTTAGG + Intergenic
990146489 5:52766732-52766754 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
990905835 5:60801885-60801907 CTCAGGGGCTCTCAGGCCTTTGG + Intronic
991072673 5:62502137-62502159 CCCTGTTTCTCTCATGCTTTGGG + Intronic
991951112 5:71947656-71947678 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
992023544 5:72649044-72649066 CCATGGAGCTCTGAGTCTTTTGG - Intergenic
992259159 5:74952796-74952818 CCCTGGAGCTCTCAGGATGCCGG - Intergenic
993036427 5:82762505-82762527 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
993093082 5:83450882-83450904 CCTGGGGGATCTCAGACTTTTGG + Intergenic
993387723 5:87279945-87279967 CCCTGGGGGTCTCAGGCCTTTGG - Intronic
993458739 5:88157444-88157466 CTCTGGGACTCACAGTCTTTTGG - Intergenic
994036070 5:95202295-95202317 CCCTTAGGTTCTCAGGCTTTTGG + Intronic
994269448 5:97759912-97759934 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
995559098 5:113361878-113361900 CCCTCTGGATCTCAGGCCTTTGG + Intronic
996110925 5:119565626-119565648 TCCAGGGGTTCTCAGGCCTTTGG - Intronic
996273443 5:121636687-121636709 CTTGGGGGCTCTTAGGCTTTAGG - Intergenic
996313074 5:122128903-122128925 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
996391881 5:122971119-122971141 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
996460428 5:123734325-123734347 GCTGGGGGCTCTCAGGCCTTCGG + Intergenic
996658228 5:125967195-125967217 TCCTAGGGCTCTCAGCCTCTTGG - Intergenic
998701353 5:144703456-144703478 GCTAGGGGCTCTCAGGCCTTTGG + Intergenic
998971553 5:147597916-147597938 TCCTGGGGCTCTCAAGCCTTTGG + Intronic
999262456 5:150246144-150246166 CCCAGGGGCTCTGAGGCATGGGG + Intronic
999410985 5:151349563-151349585 CCTTGGGGTTCTCATGCCTTTGG - Intergenic
999446627 5:151645593-151645615 CCCTGGTGCTCTCTGGGTCTTGG + Intergenic
999545735 5:152626343-152626365 CCCTGGGGCTCTCAGGCCTTTGG + Intergenic
1000249620 5:159481692-159481714 CCCTCTGGTTCTCAGGCCTTTGG - Intergenic
1000604364 5:163312488-163312510 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
1001116645 5:168946234-168946256 CCCTTGGTCTCTCAGGCCCTTGG - Intronic
1001136563 5:169107544-169107566 CCCTGGGGCTGTCACCCCTTGGG - Intronic
1001387707 5:171353586-171353608 CCCCCAGGTTCTCAGGCTTTTGG - Intergenic
1002108532 5:176892492-176892514 CCCTGGGGCTCTTAAGCTACTGG - Intronic
1002925655 6:1604615-1604637 GGCTGGGGCTCTCAGGCTGGGGG - Intergenic
1003015850 6:2466939-2466961 TCATGGGGCTCTCATGCTCTGGG - Intergenic
1003687910 6:8322919-8322941 GCCTCGGGTTCTCAGGCTTGAGG + Intergenic
1003691772 6:8361940-8361962 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1004316462 6:14592408-14592430 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1004429365 6:15529942-15529964 CACAGAGGCTCTCAGGCTTGAGG - Intronic
1004814963 6:19302874-19302896 CCCTGGGCTGCTCAGGATTTTGG + Intergenic
1004839141 6:19562645-19562667 CCCAGGGGCTCTTAGGCCTTTGG - Intergenic
1005265674 6:24109778-24109800 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1005506192 6:26470769-26470791 CCCTGAGGTTCTCAGGCCTTGGG + Intronic
1006511295 6:34522759-34522781 CCCTGAGGTCCTCAGGCCTTTGG - Intronic
1007294040 6:40807761-40807783 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1007395972 6:41578023-41578045 CCCTGGGGAGCTCAGGCCTGAGG - Exonic
1007764212 6:44151511-44151533 TCCTGGGGCTGTCAGCCTTTGGG + Intronic
1008168127 6:48166342-48166364 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1008439816 6:51520173-51520195 CCAAGGGACTCTCAGGCTCTGGG + Intergenic
1008714029 6:54266661-54266683 CTCTGCTGCTCTCAGGATTTTGG - Intergenic
1009219913 6:60970842-60970864 TCCTCTGGTTCTCAGGCTTTCGG + Intergenic
1009303386 6:62056020-62056042 CCCCTGTGCTCTGAGGCTTTAGG + Intronic
1009929062 6:70154735-70154757 GCCAGGGGCTCTCAGGCCTTCGG - Intronic
1010448967 6:75980668-75980690 GACTTGGGCTCTCAGGCCTTTGG + Intronic
1010481076 6:76355095-76355117 ACTTTTGGCTCTCAGGCTTTTGG + Intergenic
1010563800 6:77384101-77384123 GCCGGGGGCTCTCAGGCCTGTGG - Intergenic
1010617635 6:78031822-78031844 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1010629423 6:78179851-78179873 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1011324430 6:86133974-86133996 GCCAGGGACTCTCAGGCCTTTGG - Intergenic
1011530678 6:88317704-88317726 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1011715358 6:90099263-90099285 ACCTGGGTCTCTCTGACTTTAGG - Intronic
1011752321 6:90465658-90465680 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1011847161 6:91580422-91580444 GCCAGGGGCTCTTAGGCCTTTGG - Intergenic
1012158295 6:95848899-95848921 GCCAGAGGCTCTCAGGCCTTCGG - Intergenic
1012720547 6:102736890-102736912 CCCAGGGGCTCTGAGGCCTTAGG + Intergenic
1012722209 6:102758946-102758968 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1012736890 6:102959209-102959231 GCCAGGGGCTCTCTGGCCTTAGG + Intergenic
1013038643 6:106411775-106411797 CCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1013167028 6:107603780-107603802 GCCTGTGGCTCTCATGCTTTGGG + Intronic
1013416707 6:109932071-109932093 CTGGGGGGCTCTCAGGCCTTCGG - Intergenic
1013511195 6:110845665-110845687 GCCAGGGGTTCTCAGGCCTTAGG + Intronic
1013665976 6:112348810-112348832 ACCAGAGGCTCTCAAGCTTTGGG + Intronic
1013816306 6:114102482-114102504 CCCTGGGCATCTAAGGCATTGGG - Intronic
1013887519 6:114988134-114988156 TGCTAGGGCTCTCAGGTTTTTGG + Intergenic
1013935577 6:115589212-115589234 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1014020974 6:116589432-116589454 GCATGTGGCTCTCAGGCTATGGG + Intronic
1014054431 6:116997305-116997327 CCCAAGGGCTCTCAGACCTTGGG + Intergenic
1014080564 6:117281861-117281883 CCCTCAGGTTCTCAGGCTTTTGG + Intergenic
1014113961 6:117651952-117651974 GCCAGGGGCTCTCAGGACTTTGG - Intergenic
1014777610 6:125528805-125528827 CCCAGGGGCTATTATGCTTTCGG + Intergenic
1015519832 6:134119036-134119058 CCCTCAGGTTCTCAGGCCTTTGG - Intergenic
1015629052 6:135212906-135212928 GCATGGGGCTCCCAGGCTTCAGG + Intronic
1016591553 6:145750725-145750747 GCCAGGGGCTCGCAGGCCTTTGG + Intergenic
1016683340 6:146855121-146855143 GCCAGGGGCTCTAAGGCCTTTGG + Intergenic
1016778331 6:147930677-147930699 CTCAGGGGCTCTCAGGCCTCTGG - Intergenic
1016875242 6:148858271-148858293 TCCAGGGGCTCTCAGGCCTTTGG - Intronic
1017000798 6:149995879-149995901 CCCTAGGGCCCTGAAGCTTTGGG - Intergenic
1017379868 6:153815476-153815498 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1017727321 6:157284577-157284599 CCCCTGGGTTCTCAGGCCTTCGG - Intergenic
1018098857 6:160418336-160418358 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
1018208341 6:161456397-161456419 GCCAGGGGCTCTCAGGCCTTTGG + Intronic
1018534698 6:164807735-164807757 GCTAGGGGCTCTCAGGCCTTTGG - Intergenic
1019040357 6:169098921-169098943 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1019256017 7:51724-51746 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1019658242 7:2209427-2209449 TCCTGGGGCCCTCAGGCCTGTGG - Intronic
1019695045 7:2440992-2441014 GGCTGTGGCTCTCAGGCTGTGGG + Intergenic
1019954525 7:4402789-4402811 GCCAGGGGCTCTCGGGCCTTCGG - Intergenic
1020875787 7:13691966-13691988 GCCAGGGGCTCTTAGGCCTTTGG + Intergenic
1020976979 7:15018547-15018569 GCCAGGGGCTCTCGGGCTTTAGG + Intergenic
1021942427 7:25691031-25691053 TCCAGGGGCTCTCGGGCCTTCGG - Intergenic
1022470699 7:30680421-30680443 CCCTGAGGTTCACAGGCTGTGGG + Intronic
1023382475 7:39623168-39623190 CCCTGGGCGTCTCAGGGTTGAGG - Intergenic
1023627101 7:42126919-42126941 CTCTGGGGTTCTCACTCTTTTGG - Intronic
1023775271 7:43599826-43599848 CCCTGGGGTTCTGAGGCTTTTGG - Intronic
1023942519 7:44778997-44779019 GTCAGGGGCTCTCAGGCCTTAGG - Intergenic
1024090894 7:45939083-45939105 CCCTGCTGCTCTCAGGCTGCAGG - Intergenic
1025018808 7:55464514-55464536 CCAGGCAGCTCTCAGGCTTTGGG + Intronic
1026773855 7:73218990-73219012 CTCTGGGCCTCCCAGGCTCTAGG + Intergenic
1027014712 7:74772380-74772402 CTCTGGGCCTCCCAGGCTCTAGG + Intergenic
1027073319 7:75173575-75173597 CTCTGGGCCTCCCAGGCTCTAGG - Intergenic
1027580460 7:79988184-79988206 GCCAGGGGCTGTCAGGCCTTGGG + Intergenic
1027678969 7:81195110-81195132 GCCTGGGGCTCTCAGGCCTTCGG + Intronic
1027692773 7:81369128-81369150 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
1029611171 7:101627400-101627422 CCCTGGGGAGCTCAGGCCTGTGG - Intronic
1029918674 7:104238859-104238881 CCCTTGGGATCTCAGGCTTTTGG + Intergenic
1030159030 7:106488638-106488660 GCCAGGGGCTCTTGGGCTTTCGG - Intergenic
1030191460 7:106814635-106814657 CCATGGGGCTCTTATCCTTTGGG - Intergenic
1030307391 7:108032851-108032873 CCCTGGAGCATTCAAGCTTTGGG - Intronic
1030404141 7:109089181-109089203 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1030423387 7:109338808-109338830 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
1030917045 7:115328325-115328347 GCCAGGGGCTCTCAGGGCTTTGG - Intergenic
1031237190 7:119190947-119190969 GCTAGGGGCTCTCAGGCCTTCGG + Intergenic
1031239602 7:119220275-119220297 TGCAGGGGCTCTCAGGCCTTCGG - Intergenic
1031643417 7:124193468-124193490 GCCAGGGGCTCTCAGGCTTTTGG - Intergenic
1031771755 7:125852457-125852479 CCCGGGAGCTCTCAGGCTTTTGG + Intergenic
1031799322 7:126223049-126223071 CACTGGGGCTACCAGGCTCTGGG + Intergenic
1032040058 7:128552116-128552138 CCTTAGGGCTTTCAGGTTTTGGG + Intergenic
1032079255 7:128850490-128850512 CCCTGTGGCTCCCAGGCATGAGG + Intronic
1032535127 7:132656798-132656820 GTCAGGGGCTCTCAGGTTTTTGG + Intronic
1032676806 7:134137075-134137097 ACTTGGGGCGCTCAGGCTCTGGG + Exonic
1032890588 7:136190972-136190994 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1033208664 7:139443971-139443993 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1033712570 7:143963658-143963680 ACCAGGGGCTCTCGGGCCTTTGG - Intergenic
1034123216 7:148645930-148645952 GCCAGGGGCTCTCAGGCTTTTGG + Intergenic
1034747461 7:153535782-153535804 GCCAGGGGTTCTCAGGCTTTTGG + Intergenic
1034996164 7:155578380-155578402 CCTCAGGGCTCTCAGGCCTTGGG + Intergenic
1035160000 7:156943442-156943464 GCCCTGGGCTCTCAGGCTTGGGG - Intergenic
1035224822 7:157427215-157427237 CCCTGTGGCTCGCAGGCGCTGGG + Intergenic
1035305102 7:157927020-157927042 CCCTGGGGCTTCCTGTCTTTGGG - Intronic
1035305147 7:157927200-157927222 CCCTGGGGCTTCCTGTCTTTGGG - Intronic
1035385253 7:158467839-158467861 CCCGGGGGCTCCCAGGTCTTTGG - Intronic
1035673250 8:1436244-1436266 GCCCGGGGCTCTCAGGCCTTTGG - Intergenic
1035777128 8:2196645-2196667 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1037485024 8:19339062-19339084 GCCAGGGGCTCTAAGGCCTTCGG - Intronic
1037604965 8:20430362-20430384 CCCTTGTGCTCTAAGCCTTTGGG - Intergenic
1037669136 8:20999239-20999261 GGCAGGGGCTCTCAGGCCTTTGG + Intergenic
1037748607 8:21665409-21665431 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1038079743 8:24120426-24120448 ACATTTGGCTCTCAGGCTTTTGG + Intergenic
1038661143 8:29498091-29498113 CTCAGGGGCTCACAGGCTTGGGG + Intergenic
1038715033 8:29983922-29983944 GCCAAGGGCTCTCAGGCCTTTGG + Intergenic
1038739002 8:30199995-30200017 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
1039385436 8:37131509-37131531 GCCAGGGACTCTCAGGCCTTTGG - Intergenic
1039419754 8:37426382-37426404 GCCAGGGGCTTTCAGGCCTTTGG + Intergenic
1039595088 8:38784671-38784693 CCCAGGGGGAGTCAGGCTTTAGG + Intronic
1039737632 8:40349416-40349438 CCGTGGGGCTGTCAGGCATTTGG + Intergenic
1039894960 8:41710589-41710611 CCCTAGGGCACTCAGGGTTAAGG + Intronic
1039993529 8:42510999-42511021 TTCTGGGGCTCTGGGGCTTTAGG + Intronic
1040780438 8:51101481-51101503 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1041837160 8:62229422-62229444 ACCTGGGCCTCTCAGGGGTTGGG + Intergenic
1043273360 8:78362119-78362141 GTCAGGGGCTCTCAGGCCTTTGG - Intergenic
1043614042 8:82103512-82103534 GTCAGGGGCTCTCAGGCCTTCGG + Intergenic
1043910112 8:85854365-85854387 CCCCGGGGTTCTCAGGCCATTGG - Intergenic
1043951134 8:86310283-86310305 CCCAGGGGCTTTTAGGCCTTTGG + Intronic
1044167676 8:89007215-89007237 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1044231661 8:89785801-89785823 CTCTCTGGCTCTCAGGTTTTTGG - Intronic
1044330595 8:90915783-90915805 GCCAGGGGCTGTCAGGCCTTTGG - Intronic
1044606002 8:94047919-94047941 CTCTGGGGTTCCCAGGCCTTAGG + Intergenic
1044702566 8:94977717-94977739 CTGTGGGGGTCTCAGGCCTTTGG + Intronic
1044993031 8:97813237-97813259 TCCAGGGGCTCTCCGGCCTTTGG - Intronic
1045128829 8:99125213-99125235 GCCAGGGGCTCTCAGGCCTTTGG - Intronic
1045433781 8:102139059-102139081 GCCGGGGGCTCTCAGGCCTTCGG - Intergenic
1045642641 8:104268815-104268837 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1046025196 8:108713884-108713906 CCCCTGGGTTCTCAGGCCTTTGG - Intronic
1046033822 8:108817021-108817043 CACAGGGGCTCCCAGGCTCTGGG + Intergenic
1046066703 8:109205738-109205760 GCCATGGGCTCTCAGGCCTTTGG - Intergenic
1046371525 8:113315261-113315283 CCCTGTAGCTCACATGCTTTAGG + Intronic
1046432949 8:114152512-114152534 ACCAGGGGCTCTCAGGCCTTTGG + Intergenic
1048284181 8:133128915-133128937 CCCTGGTGCTCGCAGACTTGGGG - Intronic
1048634799 8:136284356-136284378 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1048841616 8:138571720-138571742 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1049208171 8:141373008-141373030 CCCTGGGGTTCCCGGGCTGTGGG - Intergenic
1049604267 8:143521731-143521753 GCCTGGGGCTCTCAGAGTCTGGG + Intronic
1049773453 8:144394197-144394219 CCCTGGGGAGCTGAGGCTCTGGG - Intronic
1049778610 8:144417504-144417526 CCTGGGAGCTCTCAGGCTCTGGG - Intergenic
1050313538 9:4377415-4377437 GCTGGGGGCTCTCAGGCCTTTGG + Intergenic
1051792745 9:20826418-20826440 TCCAGGGGCCCTCAGTCTTTTGG + Intronic
1052010999 9:23409107-23409129 CCCAGGGACTCTCAAGCCTTTGG + Intergenic
1052136965 9:24924339-24924361 CCCTTAGGTTCTCAGGCTTTTGG + Intergenic
1052561239 9:30087318-30087340 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1052718197 9:32144384-32144406 GTCAGGGGCTCTCAGGCTGTCGG + Intergenic
1052828996 9:33199557-33199579 CCCCTGGGTTCTCAGGCCTTTGG + Intergenic
1053188379 9:36037620-36037642 CCCGGGGGCTGGCAGGCTTGAGG + Intronic
1053449131 9:38178925-38178947 GCCTGGGCCTCTGATGCTTTTGG - Intergenic
1053876529 9:42551673-42551695 CCCTGGGGTTCCCAGTATTTGGG - Intergenic
1054235169 9:62550048-62550070 CCCTGGGGTTCCCAGTATTTGGG + Intergenic
1054354864 9:64050632-64050654 CCCCGAGGCTCTCAGGCCCTCGG + Intergenic
1055461590 9:76524778-76524800 GCCAGGGCCTCTCAGGCTTTTGG - Intergenic
1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG + Intronic
1055882984 9:81024073-81024095 CCTGGGGGCTCTCTGGCCTTTGG + Intergenic
1056126262 9:83538516-83538538 CGCCGGGGGTCTCAGGCTCTGGG - Intronic
1056435441 9:86571251-86571273 GCCAGGGGCTCTCAGACCTTTGG + Intergenic
1056518889 9:87381777-87381799 CCCTGAGGCTCTTTGGATTTTGG - Intergenic
1056771861 9:89483345-89483367 CCCTGTTGTTCTCAGGCTTGCGG + Intronic
1057189111 9:93076432-93076454 CCCTGGAGCTCCCAGTCTGTGGG + Intronic
1057373427 9:94495602-94495624 CCCTTGGACTCTCAGGTTCTAGG + Intergenic
1057716943 9:97502550-97502572 CCCTGCAGCTCTCAGGGCTTGGG - Intronic
1057866408 9:98685257-98685279 GGCAGGGGCTCTCAGGCCTTCGG + Intronic
1058235038 9:102479491-102479513 TCCAGGGGCTCTCAAGCCTTTGG - Intergenic
1058381326 9:104379985-104380007 GCCAGGGGCTCTCAGCCCTTTGG + Intergenic
1059550852 9:115227465-115227487 GCCAAGGGCTCTCAGGCCTTTGG - Intronic
1059985760 9:119818836-119818858 GCCGGGGGCTCTCAGGCTTTTGG + Intergenic
1060192236 9:121600242-121600264 CCCTGGGGCACCCAAGTTTTGGG + Intronic
1060268167 9:122124315-122124337 CCCCTTGGCTCTCAGGCTCTAGG + Intergenic
1060300022 9:122369719-122369741 CCCTGGGGCTCTCAGGGTGCCGG - Intergenic
1060753585 9:126191866-126191888 TCCTGGGGCTCTTGGGCCTTTGG + Intergenic
1060973778 9:127753554-127753576 CCCTGGGCCTCTCTGCCCTTCGG - Intronic
1061238156 9:129353910-129353932 CCCTGGGGCTCTAAGGAGGTGGG - Intergenic
1061862809 9:133476591-133476613 CCCGAGGGCTCCCAGGCTTCAGG + Intronic
1062068271 9:134540548-134540570 CCCCAGGGCCCTGAGGCTTTGGG + Intergenic
1062130729 9:134891735-134891757 CCCTTGGGCTCTCAGCCCTTGGG + Intergenic
1062135919 9:134928350-134928372 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1062171221 9:135135919-135135941 CCCTGGGGGCCACAGGCTGTGGG + Intergenic
1062475977 9:136727778-136727800 CCCTGAGTCGCTCAGGCTGTGGG - Intergenic
1062599137 9:137312234-137312256 CCCTCGGGCTCTCAGACTGGAGG - Intronic
1062603748 9:137333210-137333232 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
1062652602 9:137585927-137585949 CCCTGGCGCCCTGGGGCTTTTGG - Intronic
1203743202 Un_GL000218v1:19762-19784 CCCCGAGGCTCTCAGGCCCTCGG + Intergenic
1185958476 X:4519107-4519129 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1185990486 X:4889609-4889631 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
1186129939 X:6455682-6455704 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1186267797 X:7850649-7850671 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1187241157 X:17514475-17514497 GCCAGGGGCTCTCGGGCCTTTGG + Intronic
1187575720 X:20552582-20552604 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1187660292 X:21538738-21538760 GCCAGTGGCTCTCAGGCCTTCGG - Intronic
1187840233 X:23479363-23479385 GCTGGGGGCTCTCAGGCCTTTGG + Intergenic
1187901211 X:24028233-24028255 CCCAGGGGTTCTGAGGATTTAGG + Intergenic
1188015446 X:25103422-25103444 CCCTGGGATTCTTAGGCCTTTGG - Intergenic
1188163690 X:26834514-26834536 CCCGGGGGCTCTCAGGCCTTTGG + Intergenic
1188647652 X:32590716-32590738 CCCAGGGGCTCTAAGGCCTTTGG + Intronic
1188775737 X:34216150-34216172 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1188786546 X:34353466-34353488 CCAAGGGGCTCTCGGGCTTTTGG + Intergenic
1188862092 X:35270276-35270298 CCCTTGGGCTCTCAGGCTTTGGG - Intergenic
1189127536 X:38463878-38463900 CCCCAGGGCTCTGAGGCCTTTGG - Intronic
1189318989 X:40075901-40075923 CCCTGGGCCTGTCAGGCTTGGGG + Intronic
1189713905 X:43844789-43844811 CCGGTGGGCTCTCGGGCTTTTGG + Intronic
1191133727 X:57041872-57041894 GCCAGGGGCTTTCAGGCCTTTGG - Intergenic
1191719686 X:64219169-64219191 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1191875128 X:65788062-65788084 CCCAGGAGCTCTCAGGCCTGTGG + Intergenic
1192240376 X:69323606-69323628 CCCTGTTGCTCTGAGACTTTGGG - Intergenic
1192337246 X:70232219-70232241 CCCTAGGGCTTTCAGGCATTAGG + Intergenic
1192592869 X:72375475-72375497 CCCTCTGGTTCTCAGGCCTTTGG - Intronic
1192728800 X:73781427-73781449 GCCAAGGGCTCTCAGGCTTTTGG - Intergenic
1193288246 X:79738872-79738894 GCCAGGGGCTCTCGGGCCTTTGG + Intergenic
1193324558 X:80164660-80164682 GTCAGGGGCTCTCAGGCCTTTGG - Intergenic
1193568512 X:83111203-83111225 GCCAGGAGCTCTCAGGCCTTTGG - Intergenic
1193970026 X:88039501-88039523 CCAAGTGGCTCTCAGGCTCTGGG - Intergenic
1194077971 X:89420282-89420304 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1194313198 X:92340207-92340229 CCCTGTGGCTTTCTGGTTTTTGG + Intronic
1194410090 X:93546679-93546701 GCCAGAGGCTCTCAGGCTTTTGG - Intergenic
1194531277 X:95052077-95052099 GCCAGGGGCTCTCAGGCCTTCGG + Intergenic
1194591085 X:95800471-95800493 GCTGGGGGCTCTCAGGCTTTTGG + Intergenic
1194868241 X:99096149-99096171 CAGTGGGGCTATCAGGCTCTGGG + Intergenic
1195280354 X:103327338-103327360 ACCTGGGGCTCTCAGACCTTTGG - Intergenic
1195850479 X:109277092-109277114 GCCAGGGACTCTCAGGCCTTTGG + Intergenic
1197026157 X:121752145-121752167 GCCTAGGGCTCTGAGGCCTTTGG + Intergenic
1197105059 X:122703584-122703606 GCCAGGGGCTCTCAGGCCTTTGG + Intergenic
1197110136 X:122763213-122763235 GCCAGGGGCTTTCAGGCTTTTGG - Intergenic
1197347008 X:125336290-125336312 GCCAGGGGCTCTCGGGCCTTAGG + Intergenic
1197633246 X:128886451-128886473 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1197845658 X:130799311-130799333 GCCAGGAGCTCTCAGGCCTTTGG + Intronic
1198593327 X:138209064-138209086 GCCAGGGGCTCTCAGGCCTTTGG - Intergenic
1198615327 X:138452300-138452322 GCCAGGGGCTCTCGGGCTTATGG + Intergenic
1199004567 X:142680216-142680238 CCCTGTGGTTCTCAGGCCTTTGG - Intergenic
1199081086 X:143577559-143577581 GCCAGGGGCTCTCGGGCCTTTGG - Intergenic
1199131193 X:144188602-144188624 ACGTGGGGCTTTCATGCTTTTGG - Intergenic
1199233016 X:145461382-145461404 ACCAGGGGCTTTCAGGCCTTTGG - Intergenic
1199583487 X:149385734-149385756 ACCAGTGGCTCTCAGGCCTTTGG + Intergenic
1199784846 X:151095933-151095955 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1199853513 X:151741554-151741576 TCCTGGAGCTCTCAGGCTAGTGG + Intronic
1200430618 Y:3075836-3075858 GCCAGGGGCTCTCAGGCCTTCGG - Intergenic
1201156732 Y:11137229-11137251 CCCCGAGGCTCTCAGGCCCTCGG + Intergenic
1201714960 Y:17034308-17034330 GCCAGGGGCTCTCAGGCCCTTGG + Intergenic