ID: 1055641401

View in Genome Browser
Species Human (GRCh38)
Location 9:78321269-78321291
Sequence CCCAGGCACTTGGTGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055641394_1055641401 6 Left 1055641394 9:78321240-78321262 CCCTCAGTTGCCTGCCTGGAAAG 0: 1
1: 0
2: 2
3: 25
4: 207
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641395_1055641401 5 Left 1055641395 9:78321241-78321263 CCTCAGTTGCCTGCCTGGAAAGC 0: 1
1: 1
2: 5
3: 22
4: 269
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641393_1055641401 7 Left 1055641393 9:78321239-78321261 CCCCTCAGTTGCCTGCCTGGAAA 0: 1
1: 0
2: 0
3: 25
4: 218
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641392_1055641401 8 Left 1055641392 9:78321238-78321260 CCCCCTCAGTTGCCTGCCTGGAA 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641390_1055641401 11 Left 1055641390 9:78321235-78321257 CCACCCCCTCAGTTGCCTGCCTG 0: 1
1: 0
2: 4
3: 32
4: 366
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641388_1055641401 15 Left 1055641388 9:78321231-78321253 CCCACCACCCCCTCAGTTGCCTG 0: 1
1: 0
2: 0
3: 28
4: 278
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641398_1055641401 -8 Left 1055641398 9:78321254-78321276 CCTGGAAAGCGTCATCCCAGGCA 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641389_1055641401 14 Left 1055641389 9:78321232-78321254 CCACCACCCCCTCAGTTGCCTGC 0: 1
1: 0
2: 5
3: 37
4: 486
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data
1055641396_1055641401 -4 Left 1055641396 9:78321250-78321272 CCTGCCTGGAAAGCGTCATCCCA 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055641401 Original CRISPR CCCAGGCACTTGGTGTTCTG TGG Intronic
No off target data available for this crispr