ID: 1055645140

View in Genome Browser
Species Human (GRCh38)
Location 9:78356102-78356124
Sequence ACCAAAAATGTCTCTAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055645140_1055645144 26 Left 1055645140 9:78356102-78356124 CCATGTCTAGAGACATTTTTGGT No data
Right 1055645144 9:78356151-78356173 CATCTAGTTGGTAGAGGCTGAGG No data
1055645140_1055645143 20 Left 1055645140 9:78356102-78356124 CCATGTCTAGAGACATTTTTGGT No data
Right 1055645143 9:78356145-78356167 TTCTTGCATCTAGTTGGTAGAGG No data
1055645140_1055645142 14 Left 1055645140 9:78356102-78356124 CCATGTCTAGAGACATTTTTGGT No data
Right 1055645142 9:78356139-78356161 ATGTGCTTCTTGCATCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055645140 Original CRISPR ACCAAAAATGTCTCTAGACA TGG (reversed) Intergenic
No off target data available for this crispr