ID: 1055660601

View in Genome Browser
Species Human (GRCh38)
Location 9:78500116-78500138
Sequence TGGAATGACCATGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055660595_1055660601 1 Left 1055660595 9:78500092-78500114 CCAATGAGATGGTGGAAGAAGCC No data
Right 1055660601 9:78500116-78500138 TGGAATGACCATGTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055660601 Original CRISPR TGGAATGACCATGTGGAGGA GGG Intergenic
No off target data available for this crispr