ID: 1055661811

View in Genome Browser
Species Human (GRCh38)
Location 9:78511386-78511408
Sequence CCATTGGTATGGAGAGGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055661805_1055661811 6 Left 1055661805 9:78511357-78511379 CCTTTGCGAGGTCAGTGAAAAGC No data
Right 1055661811 9:78511386-78511408 CCATTGGTATGGAGAGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055661811 Original CRISPR CCATTGGTATGGAGAGGAAG CGG Intergenic
No off target data available for this crispr