ID: 1055662693

View in Genome Browser
Species Human (GRCh38)
Location 9:78520612-78520634
Sequence GCAACAGTGTTAGCAGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055662693_1055662705 27 Left 1055662693 9:78520612-78520634 CCTGAACCTGCTAACACTGTTGC No data
Right 1055662705 9:78520662-78520684 ACAGGCACACTTAGTTGACAAGG No data
1055662693_1055662700 9 Left 1055662693 9:78520612-78520634 CCTGAACCTGCTAACACTGTTGC No data
Right 1055662700 9:78520644-78520666 CTGCCCGAGGGCCCAGGGACAGG No data
1055662693_1055662699 4 Left 1055662693 9:78520612-78520634 CCTGAACCTGCTAACACTGTTGC No data
Right 1055662699 9:78520639-78520661 ATACACTGCCCGAGGGCCCAGGG No data
1055662693_1055662696 -3 Left 1055662693 9:78520612-78520634 CCTGAACCTGCTAACACTGTTGC No data
Right 1055662696 9:78520632-78520654 TGCCAGTATACACTGCCCGAGGG No data
1055662693_1055662698 3 Left 1055662693 9:78520612-78520634 CCTGAACCTGCTAACACTGTTGC No data
Right 1055662698 9:78520638-78520660 TATACACTGCCCGAGGGCCCAGG No data
1055662693_1055662695 -4 Left 1055662693 9:78520612-78520634 CCTGAACCTGCTAACACTGTTGC No data
Right 1055662695 9:78520631-78520653 TTGCCAGTATACACTGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055662693 Original CRISPR GCAACAGTGTTAGCAGGTTC AGG (reversed) Intergenic
No off target data available for this crispr