ID: 1055663275

View in Genome Browser
Species Human (GRCh38)
Location 9:78528563-78528585
Sequence GGGTTAGTCTTCTTAAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055663264_1055663275 28 Left 1055663264 9:78528512-78528534 CCACACATCAGCAAGTGACCACC No data
Right 1055663275 9:78528563-78528585 GGGTTAGTCTTCTTAAGGTCAGG No data
1055663267_1055663275 10 Left 1055663267 9:78528530-78528552 CCACCAATGGTTGGTCGTCATGC No data
Right 1055663275 9:78528563-78528585 GGGTTAGTCTTCTTAAGGTCAGG No data
1055663268_1055663275 7 Left 1055663268 9:78528533-78528555 CCAATGGTTGGTCGTCATGCTCC No data
Right 1055663275 9:78528563-78528585 GGGTTAGTCTTCTTAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055663275 Original CRISPR GGGTTAGTCTTCTTAAGGTC AGG Intergenic
No off target data available for this crispr