ID: 1055664615

View in Genome Browser
Species Human (GRCh38)
Location 9:78540946-78540968
Sequence AGCTCATATGTCTCTCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055664614_1055664615 -7 Left 1055664614 9:78540930-78540952 CCGAGTGAGGAGTCAGAGCTCAT No data
Right 1055664615 9:78540946-78540968 AGCTCATATGTCTCTCCCCATGG No data
1055664612_1055664615 9 Left 1055664612 9:78540914-78540936 CCTCTTCTTGGGGAAACCGAGTG No data
Right 1055664615 9:78540946-78540968 AGCTCATATGTCTCTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055664615 Original CRISPR AGCTCATATGTCTCTCCCCA TGG Intergenic
No off target data available for this crispr