ID: 1055669060

View in Genome Browser
Species Human (GRCh38)
Location 9:78582303-78582325
Sequence GACACTGATGTCTAGACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055669056_1055669060 -8 Left 1055669056 9:78582288-78582310 CCAAAAGCTCTGTTGGACACTGA No data
Right 1055669060 9:78582303-78582325 GACACTGATGTCTAGACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055669060 Original CRISPR GACACTGATGTCTAGACCGG GGG Intergenic
No off target data available for this crispr