ID: 1055673595

View in Genome Browser
Species Human (GRCh38)
Location 9:78632240-78632262
Sequence TGGGCCCACTTGAACTTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055673595_1055673597 -9 Left 1055673595 9:78632240-78632262 CCGCAAAAGTTCAAGTGGGCCCA No data
Right 1055673597 9:78632254-78632276 GTGGGCCCATGGAGTCTGACAGG No data
1055673595_1055673602 5 Left 1055673595 9:78632240-78632262 CCGCAAAAGTTCAAGTGGGCCCA No data
Right 1055673602 9:78632268-78632290 TCTGACAGGAAAGGAGGCTATGG No data
1055673595_1055673601 -1 Left 1055673595 9:78632240-78632262 CCGCAAAAGTTCAAGTGGGCCCA No data
Right 1055673601 9:78632262-78632284 ATGGAGTCTGACAGGAAAGGAGG No data
1055673595_1055673599 -4 Left 1055673595 9:78632240-78632262 CCGCAAAAGTTCAAGTGGGCCCA No data
Right 1055673599 9:78632259-78632281 CCCATGGAGTCTGACAGGAAAGG No data
1055673595_1055673603 6 Left 1055673595 9:78632240-78632262 CCGCAAAAGTTCAAGTGGGCCCA No data
Right 1055673603 9:78632269-78632291 CTGACAGGAAAGGAGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055673595 Original CRISPR TGGGCCCACTTGAACTTTTG CGG (reversed) Intergenic
No off target data available for this crispr