ID: 1055675639

View in Genome Browser
Species Human (GRCh38)
Location 9:78657563-78657585
Sequence TGGAGTAGGTGCTGCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055675633_1055675639 12 Left 1055675633 9:78657528-78657550 CCTCCTAGTAGCTAAAGTCAATG No data
Right 1055675639 9:78657563-78657585 TGGAGTAGGTGCTGCACCCCAGG No data
1055675635_1055675639 9 Left 1055675635 9:78657531-78657553 CCTAGTAGCTAAAGTCAATGGTA No data
Right 1055675639 9:78657563-78657585 TGGAGTAGGTGCTGCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055675639 Original CRISPR TGGAGTAGGTGCTGCACCCC AGG Intergenic
No off target data available for this crispr