ID: 1055680568

View in Genome Browser
Species Human (GRCh38)
Location 9:78710937-78710959
Sequence CTGTATCAGTAGAGTTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055680562_1055680568 19 Left 1055680562 9:78710895-78710917 CCAATTAAACCTTTTTTGTAAAT No data
Right 1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG No data
1055680565_1055680568 -6 Left 1055680565 9:78710920-78710942 CCCAGTTTCCGGTATGTCTGTAT No data
Right 1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG No data
1055680563_1055680568 10 Left 1055680563 9:78710904-78710926 CCTTTTTTGTAAATTGCCCAGTT No data
Right 1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG No data
1055680566_1055680568 -7 Left 1055680566 9:78710921-78710943 CCAGTTTCCGGTATGTCTGTATC No data
Right 1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055680568 Original CRISPR CTGTATCAGTAGAGTTAAGA TGG Intergenic
No off target data available for this crispr