ID: 1055682006

View in Genome Browser
Species Human (GRCh38)
Location 9:78724872-78724894
Sequence GTGGTAGCCCTGCCACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055682006_1055682013 8 Left 1055682006 9:78724872-78724894 CCCTCCAGTGGCAGGGCTACCAC No data
Right 1055682013 9:78724903-78724925 GTATATCTGCCAGGTGCCCAAGG No data
1055682006_1055682010 -1 Left 1055682006 9:78724872-78724894 CCCTCCAGTGGCAGGGCTACCAC No data
Right 1055682010 9:78724894-78724916 CACACCCATGTATATCTGCCAGG No data
1055682006_1055682014 13 Left 1055682006 9:78724872-78724894 CCCTCCAGTGGCAGGGCTACCAC No data
Right 1055682014 9:78724908-78724930 TCTGCCAGGTGCCCAAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055682006 Original CRISPR GTGGTAGCCCTGCCACTGGA GGG (reversed) Intergenic
No off target data available for this crispr