ID: 1055685828

View in Genome Browser
Species Human (GRCh38)
Location 9:78773693-78773715
Sequence ATCTCTTTTTAGAGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055685828_1055685832 10 Left 1055685828 9:78773693-78773715 CCCTCACTCCTCTAAAAAGAGAT No data
Right 1055685832 9:78773726-78773748 AATTGCCCTGGACCATATTTTGG No data
1055685828_1055685831 -2 Left 1055685828 9:78773693-78773715 CCCTCACTCCTCTAAAAAGAGAT No data
Right 1055685831 9:78773714-78773736 ATCAATGAAGATAATTGCCCTGG No data
1055685828_1055685836 25 Left 1055685828 9:78773693-78773715 CCCTCACTCCTCTAAAAAGAGAT No data
Right 1055685836 9:78773741-78773763 TATTTTGGATTTTATGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055685828 Original CRISPR ATCTCTTTTTAGAGGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr