ID: 1055686116

View in Genome Browser
Species Human (GRCh38)
Location 9:78776760-78776782
Sequence ATGCATTTACATCACTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055686116_1055686122 25 Left 1055686116 9:78776760-78776782 CCCTTTCAGTGATGTAAATGCAT No data
Right 1055686122 9:78776808-78776830 TGCCAAAGCAGGGCCCAGAAAGG No data
1055686116_1055686120 14 Left 1055686116 9:78776760-78776782 CCCTTTCAGTGATGTAAATGCAT No data
Right 1055686120 9:78776797-78776819 AACTGAGTCAATGCCAAAGCAGG No data
1055686116_1055686121 15 Left 1055686116 9:78776760-78776782 CCCTTTCAGTGATGTAAATGCAT No data
Right 1055686121 9:78776798-78776820 ACTGAGTCAATGCCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055686116 Original CRISPR ATGCATTTACATCACTGAAA GGG (reversed) Intergenic
No off target data available for this crispr