ID: 1055688796

View in Genome Browser
Species Human (GRCh38)
Location 9:78807949-78807971
Sequence AGGGAGAAAATAAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055688796_1055688804 8 Left 1055688796 9:78807949-78807971 CCCTCCCCATTTATTTTCTCCCT No data
Right 1055688804 9:78807980-78808002 TTGAAAAGAAATTGTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055688796 Original CRISPR AGGGAGAAAATAAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr