ID: 1055689189

View in Genome Browser
Species Human (GRCh38)
Location 9:78811158-78811180
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055689189_1055689191 24 Left 1055689189 9:78811158-78811180 CCATGCTCTAAGTGTAGTACTGC No data
Right 1055689191 9:78811205-78811227 TTTTCATTTTATTAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055689189 Original CRISPR GCAGTACTACACTTAGAGCA TGG (reversed) Intergenic
No off target data available for this crispr