ID: 1055689686

View in Genome Browser
Species Human (GRCh38)
Location 9:78816141-78816163
Sequence CTAAAAATACAGATTTAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055689680_1055689686 11 Left 1055689680 9:78816107-78816129 CCAGTCTGGCCAACATAGCGAAA 0: 47
1: 1930
2: 29762
3: 155502
4: 259767
Right 1055689686 9:78816141-78816163 CTAAAAATACAGATTTAGGCGGG No data
1055689681_1055689686 2 Left 1055689681 9:78816116-78816138 CCAACATAGCGAAATCCCATCTC 0: 22
1: 847
2: 13946
3: 81595
4: 130847
Right 1055689686 9:78816141-78816163 CTAAAAATACAGATTTAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055689686 Original CRISPR CTAAAAATACAGATTTAGGC GGG Intergenic
No off target data available for this crispr