ID: 1055693563

View in Genome Browser
Species Human (GRCh38)
Location 9:78859074-78859096
Sequence CCACATGTATACTACCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055693558_1055693563 24 Left 1055693558 9:78859027-78859049 CCATGTTTGCTATGTGGCTTGGC No data
Right 1055693563 9:78859074-78859096 CCACATGTATACTACCTGCCTGG No data
1055693556_1055693563 28 Left 1055693556 9:78859023-78859045 CCTTCCATGTTTGCTATGTGGCT No data
Right 1055693563 9:78859074-78859096 CCACATGTATACTACCTGCCTGG No data
1055693561_1055693563 2 Left 1055693561 9:78859049-78859071 CCAAAGGAAGCTTCTGTGGCTTG No data
Right 1055693563 9:78859074-78859096 CCACATGTATACTACCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055693563 Original CRISPR CCACATGTATACTACCTGCC TGG Intergenic
No off target data available for this crispr