ID: 1055695736

View in Genome Browser
Species Human (GRCh38)
Location 9:78882319-78882341
Sequence CTCTGACCCCAGTAGCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055695729_1055695736 24 Left 1055695729 9:78882272-78882294 CCTCACAGGGCATTGAAAGCGTA No data
Right 1055695736 9:78882319-78882341 CTCTGACCCCAGTAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055695736 Original CRISPR CTCTGACCCCAGTAGCTTCC AGG Intergenic
No off target data available for this crispr