ID: 1055696465

View in Genome Browser
Species Human (GRCh38)
Location 9:78890238-78890260
Sequence CTGTATCCAGACATTGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055696465_1055696468 -8 Left 1055696465 9:78890238-78890260 CCAAATGCAATGTCTGGATACAG No data
Right 1055696468 9:78890253-78890275 GGATACAGGCCTTAAGGAACTGG No data
1055696465_1055696470 14 Left 1055696465 9:78890238-78890260 CCAAATGCAATGTCTGGATACAG No data
Right 1055696470 9:78890275-78890297 GAAGCTTTTAATTCCTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055696465 Original CRISPR CTGTATCCAGACATTGCATT TGG (reversed) Intergenic
No off target data available for this crispr