ID: 1055698884

View in Genome Browser
Species Human (GRCh38)
Location 9:78919325-78919347
Sequence TATCCTACCTCTAGTTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055698883_1055698884 19 Left 1055698883 9:78919283-78919305 CCAGAGGAAGACATGCGTGTTCT No data
Right 1055698884 9:78919325-78919347 TATCCTACCTCTAGTTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055698884 Original CRISPR TATCCTACCTCTAGTTAGTT TGG Intergenic
No off target data available for this crispr