ID: 1055699572

View in Genome Browser
Species Human (GRCh38)
Location 9:78928424-78928446
Sequence CTGAACATACCAACAAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055699567_1055699572 19 Left 1055699567 9:78928382-78928404 CCTCACTCAAGTGATAGAATGAC No data
Right 1055699572 9:78928424-78928446 CTGAACATACCAACAAACAATGG No data
1055699571_1055699572 -3 Left 1055699571 9:78928404-78928426 CCAAAAGAGGGGCTGTGAGACTG No data
Right 1055699572 9:78928424-78928446 CTGAACATACCAACAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055699572 Original CRISPR CTGAACATACCAACAAACAA TGG Intergenic
No off target data available for this crispr