ID: 1055701092

View in Genome Browser
Species Human (GRCh38)
Location 9:78946727-78946749
Sequence CCCTTGGACTGCTGTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055701092_1055701098 28 Left 1055701092 9:78946727-78946749 CCACAGGCACAGCAGTCCAAGGG No data
Right 1055701098 9:78946778-78946800 TAATGATTATATGCTGAACAGGG No data
1055701092_1055701100 30 Left 1055701092 9:78946727-78946749 CCACAGGCACAGCAGTCCAAGGG No data
Right 1055701100 9:78946780-78946802 ATGATTATATGCTGAACAGGGGG No data
1055701092_1055701099 29 Left 1055701092 9:78946727-78946749 CCACAGGCACAGCAGTCCAAGGG No data
Right 1055701099 9:78946779-78946801 AATGATTATATGCTGAACAGGGG No data
1055701092_1055701097 27 Left 1055701092 9:78946727-78946749 CCACAGGCACAGCAGTCCAAGGG No data
Right 1055701097 9:78946777-78946799 TTAATGATTATATGCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055701092 Original CRISPR CCCTTGGACTGCTGTGCCTG TGG (reversed) Intergenic
No off target data available for this crispr