ID: 1055702361

View in Genome Browser
Species Human (GRCh38)
Location 9:78959214-78959236
Sequence AACCTTAAGAAATTACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055702361_1055702362 8 Left 1055702361 9:78959214-78959236 CCTGGCAGTAATTTCTTAAGGTT No data
Right 1055702362 9:78959245-78959267 GTGAAAGTCAGTCTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055702361 Original CRISPR AACCTTAAGAAATTACTGCC AGG (reversed) Intergenic
No off target data available for this crispr