ID: 1055703432

View in Genome Browser
Species Human (GRCh38)
Location 9:78971700-78971722
Sequence TCCTCGTTAGCTCATCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055703429_1055703432 1 Left 1055703429 9:78971676-78971698 CCAGAGAACAGTTGTATCTAATC No data
Right 1055703432 9:78971700-78971722 TCCTCGTTAGCTCATCCCCAGGG No data
1055703427_1055703432 23 Left 1055703427 9:78971654-78971676 CCAACAGGGTCTTGACACCTGGC No data
Right 1055703432 9:78971700-78971722 TCCTCGTTAGCTCATCCCCAGGG No data
1055703425_1055703432 29 Left 1055703425 9:78971648-78971670 CCTCTGCCAACAGGGTCTTGACA No data
Right 1055703432 9:78971700-78971722 TCCTCGTTAGCTCATCCCCAGGG No data
1055703428_1055703432 6 Left 1055703428 9:78971671-78971693 CCTGGCCAGAGAACAGTTGTATC No data
Right 1055703432 9:78971700-78971722 TCCTCGTTAGCTCATCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055703432 Original CRISPR TCCTCGTTAGCTCATCCCCA GGG Intergenic
No off target data available for this crispr