ID: 1055706648

View in Genome Browser
Species Human (GRCh38)
Location 9:79012631-79012653
Sequence GTGAAATGAATGAGTTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055706646_1055706648 23 Left 1055706646 9:79012585-79012607 CCAGTGCTACAGGTGAAGTTATT No data
Right 1055706648 9:79012631-79012653 GTGAAATGAATGAGTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055706648 Original CRISPR GTGAAATGAATGAGTTTAAG TGG Intergenic
No off target data available for this crispr