ID: 1055709010

View in Genome Browser
Species Human (GRCh38)
Location 9:79038140-79038162
Sequence AGTCAGAGTAGACCACCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055709004_1055709010 25 Left 1055709004 9:79038092-79038114 CCAGTATGACTGGGGTCACAGGG No data
Right 1055709010 9:79038140-79038162 AGTCAGAGTAGACCACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055709010 Original CRISPR AGTCAGAGTAGACCACCAGA TGG Intergenic
No off target data available for this crispr