ID: 1055716978

View in Genome Browser
Species Human (GRCh38)
Location 9:79128512-79128534
Sequence ATGTTAGTATGGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055716978_1055716984 18 Left 1055716978 9:79128512-79128534 CCAGCTTCCTTCCATACTAACAT No data
Right 1055716984 9:79128553-79128575 CTTCAGGTGAATAAGGCCCTAGG No data
1055716978_1055716983 11 Left 1055716978 9:79128512-79128534 CCAGCTTCCTTCCATACTAACAT No data
Right 1055716983 9:79128546-79128568 TGACACACTTCAGGTGAATAAGG No data
1055716978_1055716985 19 Left 1055716978 9:79128512-79128534 CCAGCTTCCTTCCATACTAACAT No data
Right 1055716985 9:79128554-79128576 TTCAGGTGAATAAGGCCCTAGGG No data
1055716978_1055716982 2 Left 1055716978 9:79128512-79128534 CCAGCTTCCTTCCATACTAACAT No data
Right 1055716982 9:79128537-79128559 CCTACTTGTTGACACACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055716978 Original CRISPR ATGTTAGTATGGAAGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr