ID: 1055719365

View in Genome Browser
Species Human (GRCh38)
Location 9:79154439-79154461
Sequence CAGGCTGTAGACTGTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055719365_1055719372 30 Left 1055719365 9:79154439-79154461 CCTCCTCCACAGTCTACAGCCTG No data
Right 1055719372 9:79154492-79154514 CCTATATACTACACAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055719365 Original CRISPR CAGGCTGTAGACTGTGGAGG AGG (reversed) Intergenic
No off target data available for this crispr